American ginseng identification DNA (deoxyribonucleic acid) hybridization method

A hybridization method and a technology for American ginseng are applied in the field of DNA hybridization for identifying American ginseng, which can solve problems such as time-consuming and cost-intensive, and achieve the effects of fast reaction speed, superior detection performance and high accuracy

Active Publication Date: 2019-02-19
珠海澳加动力生物科技有限公司
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current DNA barcoding technology used to identify American ginseng will include two steps of PCR product formation and sequence identification, and both involve gel electrophoretic separation. The process involves electric field action and special staining, which takes a lot of time and operation Technical cost, the demand for rapid identification of American ginseng is still unsatisfactory, so it is necessary to provide a technology for rapid identification of American ginseng

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • American ginseng identification DNA (deoxyribonucleic acid) hybridization method
  • American ginseng identification DNA (deoxyribonucleic acid) hybridization method
  • American ginseng identification DNA (deoxyribonucleic acid) hybridization method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] 1. Various solution configurations

[0057]Configuration of the probe solution

[0058] Take the solution and the probe, configure the probe solution, and the components of the configured probe solution are as follows:

[0059] (1) 25 μM amine-labeled oligonucleotide single-stranded

[0060] (2) 1.5M NaCl

[0061] (3) 0.15M sodium bicarbonate

[0062] (4) 0.15% sodium dodecyl sulfate (SDS)

[0063] Configuration of the sample DNA solution to be tested

[0064] Take the solution and the DNA of the sample to be tested, and configure the DNA solution of the sample to be tested, wherein the components of the DNA solution of the sample to be tested are as follows:

[0065] (1) 25nM biotin-labeled oligonucleotide single strand

[0066] (2) 0.15M NaCl

[0067] (3) 0.015M sodium citrate (pH 7.0)

[0068] (4) 0.15% sodium dodecyl sulfate (SDS)

[0069] Configuration of Gold Nanoparticle (AuNP) Solution

[0070] Before the experiment, add the AuNP storage solution to AD...

Embodiment 2

[0081] The screening of embodiment 2 probe sequence

[0082] Two types of probes were designed, respectively denoted as N1Q and N2Q, and the sequences of the two probes were:

[0083] N1Q: CTAAAAAAAAAGTATTTCTCATCTAAATTTTGAA (SEQ ID NO: 1)

[0084] N2Q: GAATTTGAAAGTGTTTTAAAATTGATTTTCAA (SEQ ID NO: 2)

[0085] Two samples of DNA to be tested were prepared, which were respectively derived from Chinese ginseng and American ginseng. The DNA sample to be tested in Chinese ginseng was recorded as Pgin, and the DNA sample to be tested in American ginseng was recorded as Pquin.

[0086] Experiment according to the operation of Example 1, wherein step (4) in Example 1 washes the microfluidic chip with 1 times of PBS buffer for the washing solution, and the experimental results are as follows image 3 shown.

[0087] From image 3 It can be seen from the above that in the reaction area where the probe N2Q is fixed, there is no significant difference in the fluorescence responses of C...

Embodiment 3

[0088] The screening of embodiment 3 gold nanoparticles solution

[0089] Experiment A

[0090] Two copies of the DNA of the sample to be tested were prepared, which were respectively derived from Chinese ginseng and American ginseng.

[0091] Carry out the experiment according to the operation of embodiment 1, wherein step (4) in the embodiment 1 washs the washing solution in the microfluidic chip: (1) group 1 uses 1 times of PBS buffer solution; (2) group 2 uses gold A solution with a concentration of nanoparticles of 5 nM; (3) a solution with a concentration of gold nanoparticles used in group 3 of 10 nM; (4) a solution with a concentration of gold nanoparticles used in group 4 of 15 nM; (5) a solution with a concentration of gold nanoparticles used in group 5 A solution with a gold nanoparticle concentration of 20nM; the experimental results are as follows Figure 4 shown.

[0092] Among them, 1, 3, 5, 7 and 9 in the vertical direction are ginseng reaction areas, and 2,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to view more

Abstract

The invention provides an American ginseng identification DNA hybridization method. An applied probe applied in the American ginseng identification DNA hybridization method is designed on the basis ofthe locus of Single Nucleotide Polymorphism (SNP) of dammarenediol synthase genes of panax genomes. Experiments of the American ginseng identification DNA hybridization method detects that Chinese ginseng, American ginseng and pseudo-ginseng are high in similarity of dammarenediol synthase genes. For identifying American ginseng more accurately, the American ginseng identification DNA hybridization method designs a number of probe sequences and screens out probe sequences capable of accurately identifying American ginseng.

Description

technical field [0001] The invention relates to a DNA hybridization method for identifying American ginseng. Background technique [0002] Chinese herbal medicine ginseng belongs to Plantae (Plantia), Apiales (Umbelliferae), Araliaceae (Araliaceae), Aralioideae (Panax subfamily), Panax (Panax) in taxonomy. There are three main species classifications under the genus Panax: Panax Ginseng (Asian ginseng / Chinese ginseng), Panax notoginseng (Panax notoginseng) and Panax Quinquefolius (American ginseng). [0003] Although Chinese ginseng, Panax notoginseng and American ginseng originate from the same genus, the uses and properties of the three Chinese herbal medicines are different. For example, Chinese ginseng does not affect the effect of warfarin, but American ginseng can significantly affect the anticoagulant properties of warfarin. [0004] Since Chinese ginseng, Panax notoginseng and American ginseng have different functions and values, the technology and means of rapid i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6837
CPCC12Q1/6837C12Q1/6895C12Q2563/131
Inventor 李志恒奥伯克·克里斯托弗
Owner 珠海澳加动力生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap