Plasmodium nucleate type detection kit and application method thereof
A technology for detecting kits and protozoan nucleic acids, which is applied in biochemical equipment and methods, measurement/testing of microorganisms, and resistance to vector-borne diseases, etc. It can solve unreliable diagnosis, inability to detect differences in Plasmodium species, and false negatives And other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0098] The present invention will be specifically introduced below in conjunction with the accompanying drawings and specific embodiments.
[0099] A Plasmodium nucleic acid typing detection kit, comprising: PCR reaction solution I containing mixed primers, PCR reaction solution II containing typing probes, Taq / UNG enzyme mixture, containing P.v, P.f, P.o, P.m mitochondrial cox3 Positive control and negative control of the recombinant plasmid of the specific region sequence of the gene;
[0100] PCR reaction solution I includes:
[0101] water;
[0102] 10×PCR buffer;
[0103] 1-25mM Mg ion;
[0104] 1-25mM dNTPs;
[0105] 1-100 μM P.v cox3 gene upstream primer VF: SEQ.ID.NO:1, CCTTACGTACTCTAGCTTTTA;
[0106] 1-100μM P.v cox3 gene downstream primer VR: SEQ.ID.NO:2, GAGTTCCTTTTTCTATTCAGAATAA;
[0107] 1-50 μM P.v cox3 gene probe VP: SEQ.ID.NO:9,
[0108] CAATATTATTTGTCTATACTAGATACTATAGTT;
[0109] 1-100 μM P.f cox3 gene upstream primer FF: SEQ.ID.NO:3, CCTTACGTACTCTAGCT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



