Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for selecting mstn gene molecular markers for growth traits of Chinese soft-shelled turtle

A growth trait and molecular marker technology, applied in the field of molecular biology, to improve the efficiency of seed selection, and the selection method is simple and effective.

Active Publication Date: 2022-05-06
FISHERIES RES INST ANHUI ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Facing the strong demand for Chinese soft-shelled turtle varieties, traditional breeding methods are far from being able to meet it. It is necessary to carry out molecular marker-assisted breeding of Chinese soft-shelled turtles to improve selection efficiency and speed up the breeding process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for selecting mstn gene molecular markers for growth traits of Chinese soft-shelled turtle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] In order to better understand the present invention, the present invention will be further described below in conjunction with the examples, and the following examples are only to illustrate the present invention and not to limit it.

[0022] 1. Chinese soft-shelled turtle MSTN Gene DNA sequence PCR amplification and polymorphism detection

[0023] 1. Chinese soft-shelled turtle MSTN PCR amplification of gene DNA sequence

[0024] Chinese soft-shelled turtle downloaded from NCBI MSTN The full-length sequence of the gene (GenBank No: NW_005852453.1) designed specific amplification primers P1 and P2, using 30 Chinese soft-shelled turtle genome DNA as a template, in Taq Under the buffer environment of PCR master mix, the primers P1 and P2 were used to amplify under PCR conditions, and the product was purified and sequenced to obtain the target fragment with a length of 417 bp.

[0025] The primer sequences are as follows:

[0026] P1: TCTGTTTATATGATATGCTGGC (SEQ ID N...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for the growth traits of soft-shelled soft-shelled turtle MSTN Gene molecular marker selection method, that is in soft-shelled soft-shelled turtle MSTN A SNP site on the first intron sequence in the gene, starting from the start codon, is T2194C. Screening out the genes closely related to growth traits in soft-shelled turtle populations MSTN The breeding marker of the gene, and screening and constructing the breeding population of soft-shelled turtle with the breeding marker in the breeding population of Chinese soft-shelled turtle. This method can improve the accuracy of selection of growth traits of Soft-shelled Soft-shelled Turtle, laying the foundation and providing reference for molecular marker-assisted breeding of Soft-shelled Soft-shelled Turtle.

Description

technical field [0001] The present invention relates to Chinese soft-shelled turtle MSTN The invention relates to a detection method and an application scope of a gene sequence SNP site, which belong to the field of molecular biology. Background technique [0002] Growth traits are one of the important economic traits of soft-shelled turtles, which are affected by many genetic and environmental factors such as muscle growth and development. Selection of growth traits through phenotype often progresses slowly in genetics. Finding the main genes and genetic markers that control the growth traits of soft-shelled turtles, and using molecular marker-assisted selection can speed up the breeding process, which is of great significance for improving the growth performance of soft-shelled turtles. [0003] Myostatin gene (Myostation, MSTN ), which is a member of the transforming growth factor-beta (TGF-β) superfamily, plays a negative role in regulating animal muscle growth and dev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6806C12Q1/6888
CPCC12Q1/6806C12Q1/6888C12Q2600/124C12Q2600/156C12Q2531/113
Inventor 黄龙何吉祥吴本丽陈静汪翔宋光同张烨
Owner FISHERIES RES INST ANHUI ACAD OF AGRI SCI