Unlock instant, AI-driven research and patent intelligence for your innovation.

A Molecular Marker Closely Related to Sclerotinia Stem Resistance of Rapeseed and Its Application

A rapeseed sclerotinia and molecular marker technology, applied in the fields of rapeseed breeding and molecular biology, to achieve the effect of improving selection efficiency, reducing workload, and enhancing targeting

Active Publication Date: 2021-10-08
SOUTHWEST UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many QTLs have been found, there are few reports on molecular markers that can be used in the breeding of rapeseed against sclerotinia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Marker Closely Related to Sclerotinia Stem Resistance of Rapeseed and Its Application
  • A Molecular Marker Closely Related to Sclerotinia Stem Resistance of Rapeseed and Its Application
  • A Molecular Marker Closely Related to Sclerotinia Stem Resistance of Rapeseed and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] A molecular marker closely related to stem resistance to Sclerotinia sclerotiorum, obtained by the following method:

[0025] Taking the segregation population of F2 clones developed from a Sclerotinia-susceptible cabbage and a disease-resistant B. incana as an example, the methods for obtaining molecular markers closely related to stem resistance are described in detail, as follows:

[0026] (1) Population construction and phenotypic identification

[0027] One part of Sclerotinia-susceptible cabbage and one part of disease-resistant cabbage B.incana were crossed to produce the F1 generation. After the F1 generation inbreds germinated, each F2 genotype was multiplied to more than 20 copies by tissue culture technology, and planted after rooting In Datian, 149 F2 generation clones were obtained. Field planting adopts random block design, setting 2 field repetitions, and planting for 2 years. The identification of Sclerotinia resistance was carried out 2 weeks after fl...

Embodiment 2

[0036] The application of a molecular marker closely related to the stem resistance of rape sclerotinia in rapeseed anti-sclerotinia breeding, the steps are:

[0037] Using antibacterial Sclerotinia cabbage B. incana to cross a susceptible Chinese cabbage, and through embryo rescue and chromosome doubling to obtain synthetic Brassica napus, 221 F2 generation plants produced by self-crossing were used as research materials. The developed markers were identified as follows:

[0038] 1) Using the DNA of a synthetic Brassica napus strain as a template;

[0039] 2) Use the following primers to carry out the PCR process on the template respectively:

[0040] tag name Forward primer sequence (5'→3') Reverse primer sequence (5'→3') SWUC797 GGACTTACTGCAACGGGAAA ATTCTCTCGAACTTCGCCCT SWUC934 TTCACACTCCCGATCTCTCC AGATTCCCTCCCCAACAAGT

[0041] 3) PCR reaction system: the total volume is 10ul, and the specific components are as follows:

[0042]

[004...

Embodiment 3

[0048] The difference between this embodiment and embodiment 2 is that the rapeseed group in this embodiment is different, and others are the same as embodiment 2.

[0049] B.incana was crossed with Brassica napus Zhongshuang 11 by using the disease-resistant Brassica napus B. incana, and hexaploid was obtained after chromosome doubling, BC1F1 was obtained by one round of backcrossing with Zhongshuang 11, BC1F2 was obtained by self-crossing, and obtained by chromosome number identification 2n=38 Brassica napus strains were continuously selfed and subjected to resistance identification and screening to obtain 255 materials of the BC1F6 generation. Using the markers developed in Example 1, the BC1F6 generation materials were analyzed according to the steps in Example 2 After identification, the results are as follows:

[0050] Among the 255 BC1F6 materials, 52 materials were able to amplify specific bands with marker SWUC797 and marker SWUC934, which were judged to contain QTL "...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
lengthaaaaaaaaaa
lengthaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical fields of rapeseed breeding and molecular biology, and in particular relates to a molecular marker closely related to the stem resistance of rapeseed sclerotinia and its application. The comprehensive use of the molecular marker can predict the relative high and low. Using the total DNA of Raisin napus strain as a template, PCR amplification was carried out using the above two primers, and the amplified products were separated by electrophoresis, and a specific band could be obtained respectively. Individuals who could amplify the above two specific bands at the same time were judged as Materials containing markers corresponding to QTLs for disease resistance are predicted to have a relatively high level of stem resistance and can be retained for later identification of resistance. The molecular marker developed by the present invention can be used for the identification and prediction of the resistance of rapeseed sclerotinia sclerotinia stalks, the operation is simple and the method is easy to implement, it solves the problems in conventional breeding methods that the selection and identification must be carried out in the later stage, and reduces the workload in the later stage , to speed up the breeding process of improving resistance to Sclerotinia sclerotiorum.

Description

technical field [0001] The invention belongs to the fields of rapeseed breeding and molecular biology, and in particular relates to a molecular marker closely related to the stem resistance of rapeseed sclerotinia, and also relates to the application of the molecular marker in breeding antisclerotinia rapeseed. Background technique [0002] China is a big planting country of rapeseed (Brassica napus), accounting for one-third of the world’s rapeseed planting area, but the per unit area yield of rapeseed in my country has always been at the world’s average level, and the annual reduction in rapeseed production due to Sclerotinia sclerotiorum is about 10~ 80%. Breeding disease-resistant varieties is the most economical and effective way to solve the hazards of Sclerotinia sclerotiorum. Breeders have bred a batch of disease-resistant rapeseed varieties through systematic breeding, such as 'Zhongyou 821' and 'Zhongshuang' series varieties, etc. These The promotion and planting o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 梅家琴邵超国钱伟丁一娟李月华
Owner SOUTHWEST UNIV