A Molecular Marker Closely Related to Sclerotinia Stem Resistance of Rapeseed and Its Application
A rapeseed sclerotinia and molecular marker technology, applied in the fields of rapeseed breeding and molecular biology, to achieve the effect of improving selection efficiency, reducing workload, and enhancing targeting
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] A molecular marker closely related to stem resistance to Sclerotinia sclerotiorum, obtained by the following method:
[0025] Taking the segregation population of F2 clones developed from a Sclerotinia-susceptible cabbage and a disease-resistant B. incana as an example, the methods for obtaining molecular markers closely related to stem resistance are described in detail, as follows:
[0026] (1) Population construction and phenotypic identification
[0027] One part of Sclerotinia-susceptible cabbage and one part of disease-resistant cabbage B.incana were crossed to produce the F1 generation. After the F1 generation inbreds germinated, each F2 genotype was multiplied to more than 20 copies by tissue culture technology, and planted after rooting In Datian, 149 F2 generation clones were obtained. Field planting adopts random block design, setting 2 field repetitions, and planting for 2 years. The identification of Sclerotinia resistance was carried out 2 weeks after fl...
Embodiment 2
[0036] The application of a molecular marker closely related to the stem resistance of rape sclerotinia in rapeseed anti-sclerotinia breeding, the steps are:
[0037] Using antibacterial Sclerotinia cabbage B. incana to cross a susceptible Chinese cabbage, and through embryo rescue and chromosome doubling to obtain synthetic Brassica napus, 221 F2 generation plants produced by self-crossing were used as research materials. The developed markers were identified as follows:
[0038] 1) Using the DNA of a synthetic Brassica napus strain as a template;
[0039] 2) Use the following primers to carry out the PCR process on the template respectively:
[0040] tag name Forward primer sequence (5'→3') Reverse primer sequence (5'→3') SWUC797 GGACTTACTGCAACGGGAAA ATTCTCTCGAACTTCGCCCT SWUC934 TTCACACTCCCGATCTCTCC AGATTCCCTCCCCAACAAGT
[0041] 3) PCR reaction system: the total volume is 10ul, and the specific components are as follows:
[0042]
[004...
Embodiment 3
[0048] The difference between this embodiment and embodiment 2 is that the rapeseed group in this embodiment is different, and others are the same as embodiment 2.
[0049] B.incana was crossed with Brassica napus Zhongshuang 11 by using the disease-resistant Brassica napus B. incana, and hexaploid was obtained after chromosome doubling, BC1F1 was obtained by one round of backcrossing with Zhongshuang 11, BC1F2 was obtained by self-crossing, and obtained by chromosome number identification 2n=38 Brassica napus strains were continuously selfed and subjected to resistance identification and screening to obtain 255 materials of the BC1F6 generation. Using the markers developed in Example 1, the BC1F6 generation materials were analyzed according to the steps in Example 2 After identification, the results are as follows:
[0050] Among the 255 BC1F6 materials, 52 materials were able to amplify specific bands with marker SWUC797 and marker SWUC934, which were judged to contain QTL "...
PUM
| Property | Measurement | Unit |
|---|---|---|
| length | aaaaa | aaaaa |
| length | aaaaa | aaaaa |
| length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


