Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker related with sheep tail fat weight and applications thereof

A molecular marker, sheep tail fat technology, applied in the direction of recombinant DNA technology, microbial determination/inspection, DNA/RNA fragment, etc., can solve the problems of increasing the cost of breeding, and achieve the effect of low cost, low cost and low operation method.

Active Publication Date: 2019-04-30
GANSU AGRI UNIV
View PDF6 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, with large-scale breeding, continuous expansion of herdsmen’s settlements, continuous improvement of forage planting and other supporting facilities, excessive tail fat deposition is of little significance to sheep itself, and considering the cost of breeding, the production of 1kg of fat-consuming feed Grass can produce 2kg lean meat, obviously too much fat deposition will also increase the cost of farming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker related with sheep tail fat weight and applications thereof
  • Molecular marker related with sheep tail fat weight and applications thereof
  • Molecular marker related with sheep tail fat weight and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1 Amplification of ADRA2A gene

[0041] (1) Primer design

[0042] Using the sheep ADRA2A gene DNA (GenBank accession number: NC_019479.2) as a template, a pair of primers M-F and M-R were designed using Primer 5.0 software. The primer sequences are as follows

[0043] ADRA2A:

[0044] Forward primer M-F: 5'-GGTGGTCATCGGCGTGTT-3' (SEQ ID NO: 2),

[0045] Reverse primer M-R: 5'-CCCTCCCAGCCAGTTCTTT-3' (SEQ ID NO: 3).

[0046] (2) Amplification and sequencing of ADRA2A gene

[0047] The total volume of the PCR reaction is 25 μL, including 1 μL of DNA template, 12.5 μL of 2×PCR Master Mix, 0.8 μL of upstream primer, 0.8 μL of downstream primer, ddH 2 O 10 μL. The PCR amplification program was: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 63.7°C for 30 s, extension at 72°C for 30 s, 35 cycles, and finally extension at 72°C for 10 min. The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and a 411bp spe...

Embodiment 2

[0050] Embodiment 2, establishment of genotyping detection method

[0051] (1) KASPar primer sequence design

[0052] A KASPar primer pair is designed for the C / A polymorphic site of the amplified fragment in Example 1, so as to be used for the specific detection of the polymorphic site, and the nucleotide sequence of the KASPar primer pair is:

[0053] Forward primer A1 for detection of AlleleA:

[0054] GAAGGTGACCAAGTTCATGCTAGCGGACTCCACACTCACACT (SEQ ID NO: 4);

[0055] Forward primer A2 used to detect AlleleC:

[0056] GAAGGTCGGAGTCAACGGATTGCGGACTCCACACTCACACG (SEQ ID NO: 5);

[0057] Universal reverse primer C: CGCGCCTTCAAGAAGATCCTCTG (SEQ ID NO: 6).

[0058] The above primers were synthesized by entrusting Beijing Sangong Bioengineering Co., Ltd., and the primers of each group in the KASPar primer pair were diluted to 10 μmol / L, and mixed according to the volume ratio of 12:12:30 (primer A1: primer A2: primer C) Evenly reserve.

[0059] (2) DNA quality control

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker related with the sheep tail fat weight, and a detection method and applications thereof. A sheep ADRA2A gene is subjected to PCR amplification and sequence analysis, people find that one C / A polymorphic site exists on the 217th of an amplified fragment, then a KASPar primer pair is used to detect the polymorphic site of 161 Hu sheep, a least square methodmodel is established, the relationship between genotype and the tail fat weight is analyzed, and the amplified ADRA2A gene fragment can be used as a molecular marker related with the sheep tail fat weight. The provided molecular marker can be used to breed species of low-fat type sheep and low-fat type meat sheep, a genetic engineering method is provided for the improvement of genes related with sheet meat quality, and the method has a high application value.

Description

technical field [0001] The invention belongs to the technical field of molecular marker preparation, and specifically relates to ADRA2A gene fragments as molecular markers affecting sheep tail fat weight and application thereof. Background technique [0002] Sheep were the first domesticated herbivorous livestock, dating back to the end of the Mesolithic period 11,000 years ago. During the long domestication process, animal behavior, body shape and appearance, as well as important economic traits have undergone great changes due to artificial selection and the influence of the natural environment. Studies have shown that wild sheep belonged to thin-tailed sheep at first, but due to artificial domestication and natural selection, some thin-tailed sheep evolved into fat-tailed sheep. The fat tail (buttocks) trait of sheep is a necessary trait for survival in harsh natural environments. In harsh ecological environments such as freezing and nutrient deficiencies, fat tail sheep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 王维民张德印张小雪李冲喇永富李国泽
Owner GANSU AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com