Molecular marker related with sheep tail fat weight and applications thereof
A molecular marker, sheep tail fat technology, applied in the direction of recombinant DNA technology, microbial determination/inspection, DNA/RNA fragment, etc., can solve the problems of increasing the cost of breeding, and achieve the effect of low cost, low cost and low operation method.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment 1 Amplification of ADRA2A gene
[0041] (1) Primer design
[0042] Using the sheep ADRA2A gene DNA (GenBank accession number: NC_019479.2) as a template, a pair of primers M-F and M-R were designed using Primer 5.0 software. The primer sequences are as follows
[0043] ADRA2A:
[0044] Forward primer M-F: 5'-GGTGGTCATCGGCGTGTT-3' (SEQ ID NO: 2),
[0045] Reverse primer M-R: 5'-CCCTCCCAGCCAGTTCTTT-3' (SEQ ID NO: 3).
[0046] (2) Amplification and sequencing of ADRA2A gene
[0047] The total volume of the PCR reaction is 25 μL, including 1 μL of DNA template, 12.5 μL of 2×PCR Master Mix, 0.8 μL of upstream primer, 0.8 μL of downstream primer, ddH 2 O 10 μL. The PCR amplification program was: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 63.7°C for 30 s, extension at 72°C for 30 s, 35 cycles, and finally extension at 72°C for 10 min. The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and a 411bp spe...
Embodiment 2
[0050] Embodiment 2, establishment of genotyping detection method
[0051] (1) KASPar primer sequence design
[0052] A KASPar primer pair is designed for the C / A polymorphic site of the amplified fragment in Example 1, so as to be used for the specific detection of the polymorphic site, and the nucleotide sequence of the KASPar primer pair is:
[0053] Forward primer A1 for detection of AlleleA:
[0054] GAAGGTGACCAAGTTCATGCTAGCGGACTCCACACTCACACT (SEQ ID NO: 4);
[0055] Forward primer A2 used to detect AlleleC:
[0056] GAAGGTCGGAGTCAACGGATTGCGGACTCCACACTCACACG (SEQ ID NO: 5);
[0057] Universal reverse primer C: CGCGCCTTCAAGAAGATCCTCTG (SEQ ID NO: 6).
[0058] The above primers were synthesized by entrusting Beijing Sangong Bioengineering Co., Ltd., and the primers of each group in the KASPar primer pair were diluted to 10 μmol / L, and mixed according to the volume ratio of 12:12:30 (primer A1: primer A2: primer C) Evenly reserve.
[0059] (2) DNA quality control
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


