Method for constructing FSCN1 gene stable knockout cell line, plasmid or plasmid combination and application thereof

A FSCN1 and gene knockout technology, which is applied in the field of molecular biology, can solve problems such as knockout of FSCN1 gene that have not yet been seen, and achieve the effect of increasing the positive rate

Inactive Publication Date: 2019-05-03
FIRST HOSPITAL OF SHANXI MEDICAL UNIV +2
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on knocking out the FSCN1 gene using the CRISPR / Cas9 system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing FSCN1 gene stable knockout cell line, plasmid or plasmid combination and application thereof
  • Method for constructing FSCN1 gene stable knockout cell line, plasmid or plasmid combination and application thereof
  • Method for constructing FSCN1 gene stable knockout cell line, plasmid or plasmid combination and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1, Construction of the Hep-2 cell line knocking out the FSCN1 gene (dual target combination method)

[0049] 1. Human FSCN1 gene knockout sgRNA design

[0050] The human FSCN1 gene is located on chromosome 7 of the human genome, with a full length of 13852bp, consisting of 5 exons and 4 introns. Its protein coding sequence is located at: 133..964, 10453..10609, 10692..10813, 11059..11226, 12468..12670. The protein coding sequence (133..964, Seq-No.7) in the first exon of the FSCN1 gene and the protein coding sequence (12468..12670, Seq-No.8) in the fifth exon were input respectively Online design website: http: / / crispr.mit.edu / , select unique genomic region (23-500nt) for the sequence type, and obtain a series of sgRNAs. On this basis, suitable target sequences are screened. It was found that the two sgRNA sequences, "TACCTGACGGCCGAGGCGTT (Seq-No.1)" located in the first exon and "GGGGTCCACGGTTTCCGCCG (Seq-No.2)" located in the fifth exon, had an off-target e...

Embodiment 2

[0105] Embodiment 2, the construction of the Hep-2 cell line of knocking out FSCN1 gene (single target method)

[0106] 1. Human FSCN1 gene knockout sgRNA design

[0107] With above-mentioned embodiment 1.

[0108] 2. Construction of pSpcas9(BB)-2A-puro recombinant plasmid expressing FSCN1sgRNA

[0109] With above-mentioned embodiment 1.

[0110] 3. Transfection and monoclonal screening and identification

[0111] The recombinant plasmid pSpcas9(BB)-gRNA-FSCN1-1 or pSpcas9(BB)-gRNA-FSCN1-2 constructed in Example 1 was separately transfected into Hep-2 cells, and the specific operation steps were as follows:

[0112] 1. Spread an appropriate amount of Hep-2 cells on a 60mm cell culture dish and culture overnight. The medium used is DMEM medium without antibiotics and containing 10% FBS. The next day, the cells grow to about 70% confluence before proceeding to the next step.

[0113] 2. Dilute the recombinant plasmid pSpcas9(BB)-gRNA-FSCN1-1 (8μg) or pSpcas9(BB)-gRNA-FSCN1-2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the technical field of molecular biology, relates to a method for constructing a FSCN1 gene stable knockout cell line, a plasmid or a plasmid combination and an application thereof, aims at instability and incompleteness of a method for siRNA transient knockout of FSCN1 gene and provides a method for stable knockout of the FSCN1 gene from genome. The method is usedfor studying functions of the FSCN1 and can also be used for constructing the FSCN1 gene knockout cell line. The provided method for constructing the FSCN1 gene knockout cell line is based on a CRISPR-Cas9 system. The method uses "N18 or N20" of a fragment meeting 5'-G-N18-NGG-3' or 5'-G-N20-NGG-3' or 5'-CCN-N18-C-3' or 5'-CCN-N20-C-3' sequence regular array in a protein coding sequence in a first exon and a protein coding sequence in a fifth exon of the human FSCN1 gene as a target sequence; and N represents any one of A, T, C and G, wherein "N18" and "N20" are 18 and 20 deoxynucleotides,respectively.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a method for constructing FSCN1 gene stable knockout cell lines, plasmids or plasmid combinations and applications. Background technique [0002] Laryngeal squamous cell carcinoma (LSCC) originates from the epithelium of the laryngeal mucosa and ranks second among head and neck malignancies. In recent years, its incidence has been on the rise in my country. Among the biological characteristics of tumor cells, invasion and metastasis are the main characteristics of malignant tumors and the primary factor causing the death of patients with malignant tumors. According to clinical statistics, more than 80% of cancer patients die from invasion and metastasis. The larynx has the characteristics of loose tissue structure and rich submucosal lymphoid tissue, which makes laryngeal squamous cell carcinoma have the malignant biological behavior of local invasion and early cervical ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/113C12N15/85C12N15/66C12N15/90
Inventor刘红亮吴勇延高伟汤叶美殷宏雨张宇良牛敏郑希望薛绪亭崔佳佳
OwnerFIRST HOSPITAL OF SHANXI MEDICAL UNIV