Labeling-free and separation-free portable gene detection method based on glucometer detection

Abstract

The invention relates to a labeling-free and separation-free portable gene detection method based on glucometer detection. The labeling-free and separation-free portable gene detection method comprises the following steps: step 1, constructing a detection vector comprising a sensor sequence and a sucrase sequence, wherein the sensor sequence is as follows: TTTCGCTCTATTCTCATCAGTTTCATGTCCTGTGTCGGACTTTAGAACAGAGGGAGATAAAGATGGACACAGGACACAACCTGGCGGCAGCGCAAAAGATGCGTAAA; the sucrase sequence is obtained by carrying out codon optimization on an amino acid sequence of high-temperature-resisting sucrase;the sensor sequence is connected with the sucrase sequence and the sequences are commonly imported into a pET-21a vector; step 2, detecting a gene to be detected by utilizing the detection vector constructed by step 1 through a glucometer. According to the method provided by the invention, an early-period purification and labeling process does not need to be carried out and an operation process is simple; furthermore, the sucrase does not exist in a detection system; compared with a traditional method, the background leakage is relatively low. Compared with an original foothold mediated geneexpression detection manner, the method takes the high-temperature-resisting sucrase to replace beta galactosidase, fluorescin, ethanol acetyl transferase, transpeptidase and the like; the commercialglucometer is used for detecting and has better portability; meanwhile, the lower gene concentration can be detected.

Description

technical field [0001] The invention relates to a gene detection method, in particular to a label-free and separation-free portable gene detection method based on blood glucose meter detection. Background technique [0002] With the development of the field of nucleic acid molecules, it has become possible to use nucleic acids to diagnose various diseases quickly and accurately. However, these detection methods usually require complex instruments, which is not conducive to the realization of portable disease diagnosis. The only few portable diagnostic products on the market are very valuable for establishing and developing new portable diagnostic methods, such as glucose detectors (glucose meters). At present, relevant literature has reported that blood glucose meters are used for gene detection (Angew.Chem.Int.Ed.2018, 57, 1-6; Anal Chem, 2015, 87, 7676-7682; 86, 3869-3875; Nat Chem, 2011, 3, 697-703). These methods first need to express a large amount of sucrase, and th...

AI Technical Summary

Problems solved by technology

The defect of this method is: 1. Invertase always exists in the detection solution during the reaction process, so in the absence of the gene to be tested, the invertase that is not stably combined with the magnetic ball is easy to dissociate into the solution, causing detection The system has a high background leakage, that is, when there is no gene to be tested, it still has a high reading of the blood glucose meter; 2. The pre-expression and purification of sucrase and the connection with DNA and DNA and magnetic balls are complicated and difficult to operate; 3. Cannot Achieve label-free and separation-free detection

The detection limit of the above characterization method can only reach 30nM when no constant temperature amplification reaction is added

(2) When detecting a new gene to be tested, due to the different sequences of the new gene to be tested, the combined footholds are different. In order to make the detection sensor have a higher signal ratio, it is often necessary to redesign the entire sensor sequence. The process is very complicated

Images