Detection carrier based on blood glucose meter detection

Abstract

The invention relates to a detection carrier based on blood glucose meter detection. The detection carrier comprises a sensor sequence and a sucrase sequence. The sensor sequence is: TTTCGCTCTATTCTCATCAGTTTCATGTCCTGTGTCGGACTTTAGAACAGAGGAGATAAAGATGGACACAGGACACAACCTGGCGGCAGCGCAAAAGATGCGTAAA. The sucrase sequence is obtained by codon optimization of the amino acid sequence of the high temperature resistant sucrose. The sensor sequence and the sucrase sequence are connected together and introduced into a pET 21a vector together. Compared with the traditional target gene detection with the sucroseas a marker, the detection carrier based on the blood glucose meter detection does not require the preliminary purification and marking process, and the operation process is simple. In addition, the sucrase does not exist in the detection system. Compared with the traditional method, the detection carrier is relatively low in background leakage. Compared with the original foothold-mediated gene expression detection method, the detection carrier adopts the sucrose to replace the beta-galactosidase, fluorescent proteins, ethanol acetyltransferase, transpeptidase and the like, utilizes a commercial blood glucose meter for detection, is more portable and can detect lower gene concentration at the same time.

Description

technical field [0001] The invention relates to a carrier, in particular to a detection carrier based on blood glucose meter detection. Background technique [0002] With the development of the field of nucleic acid molecules, it has become possible to use nucleic acids to diagnose various diseases quickly and accurately. However, these detection methods usually require complex instruments, which is not conducive to the realization of portable disease diagnosis. The only few portable diagnostic products on the market are very valuable for establishing and developing new portable diagnostic methods, such as glucose detectors (glucose meters). At present, relevant literature has reported that blood glucose meters are used for gene detection (Angew.Chem.Int.Ed.2018, 57, 1-6; Anal Chem, 2015, 87, 7676-7682; 86, 3869-3875; Nat Chem, 2011, 3, 697-703). These methods first need to express a large amount of sucrase, and then after a complicated separation and purification process...

AI Technical Summary

Problems solved by technology

The defect of this method is: 1. Invertase always exists in the detection solution during the reaction process, so in the absence of the gene to be tested, the invertase that is not stably combined with the magnetic ball is easy to dissociate into the solution, causing detection The system has a high background leakage, that is, when there is no gene to be tested, it still has a high reading of the blood glucose meter; 2. The pre-expression and purification of sucrase and the connection with DNA and DNA and magnetic balls are complicated and difficult to operate; 3. Cannot Achieve label-free and separation-free detection

The detection limit of the above characterization method can only reach 30nM when no constant temperature amplification reaction is added

(2) When detecting a new gene to be tested, due to the different sequences of the new gene to be tested, the combined footholds are different. In order to make the detection sensor have a higher signal ratio, it is often necessary to redesign the entire sensor sequence. The process is very complicated

Images