Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for acquiring stem cell-derived skeletal muscle cells based on Rbm24 gene

A skeletal muscle cell and rbm24 technology, applied in the field of stem cell regenerative medicine and medicine, can solve the problems of skeletal muscle-like cell viability and efficiency to be improved, and achieve the effect of solving the problem of high efficiency and effectiveness and widely used in large quantities

Inactive Publication Date: 2019-07-09
XIAMEN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although studies have confirmed that stem cells can differentiate into skeletal muscle-like cells[1], the viability and efficiency of differentiated skeletal muscle-like cells need to be improved[2]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for acquiring stem cell-derived skeletal muscle cells based on Rbm24 gene
  • Method for acquiring stem cell-derived skeletal muscle cells based on Rbm24 gene
  • Method for acquiring stem cell-derived skeletal muscle cells based on Rbm24 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0049] The present invention will be further described below in conjunction with specific examples.

[0050] Cloning and vector construction of Rbm24 gene:

[0051] According to the gene sequence of Rbm24 in the GenBank database, design primers to amplify the upstream and downstream primers of the Rbm24 gene:

[0052] Upstream primer: 5'—CATATGATGCACACGACCCAGAAGGAC—3';

[0053] Downstream primer: 5'—ACTAGTCTATTGCATTCGGTCTGTCTGC—3';

[0054] The upstream and downstream primers contain restriction sites for XhoI and KpnI.

[0055] The Rbm24 gene PCR amplification reaction system is 50 μl, including: FastPfu Fly DNA Polymerase, FastPfu Fly Buffer, Primer, dNTPs, cDNA, etc. The reaction program is: 95°C for 2 min, 1 cycle; 95°C for 20 sec, 60°C for 20 sec, 72°C for 10 sec, 35 cycles; 72°C for 5 min, 1 cycle.

[0056] The PCR product was recovered and purified to obtain the Rbm 24 gene fragment, which was then cloned into the pcDNA3.1 eukaryotic expression vector to construct a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for acquiring stem cell-derived skeletal muscle cells based on Rbm24 gene, and relates to stem cell regenerative medicine and drugs. The expression vector constructedbased on the Rbm24 gene sequence comprises Rbm24 gene, fluorescent reporter gene and antibiotic screening gene, nucleotide sequences of which are shown in a sequence table; the stem cells are embryonic stem cells or induced pluripotent stem cells. The invention discloses an application of the Rbm24 gene transfected pluripotent stem cells in promoting the differentiation of pluripotent stem cells into skeletal muscle. The invention further discloses an application of the Rbm24 gene infected pluripotent stem cells in promoting the differentiation of pluripotent stem cells into skeletal muscle. The method includes constructing a transfection vector containing a gene sequence containing encoded RNA binding protein Rbm24; transfecting the constructed transfection vector into stem cells; and after transfection, using skeletal muscle directional differentiation inducing fluid to induce differentiation until mature skeletal muscle cells are obtained.

Description

technical field [0001] The invention relates to stem cell regenerative medicine and medicine, in particular to a method for obtaining stem cell-derived skeletal muscle cells based on the Rbm24 gene. Background technique [0002] Stem cell-based regenerative medicine has opened up a new and broad field for the development of life science, medicine and drug research and development. Researchers believe that stem cell (regenerative medicine) research has the potential to change the way humans respond to disease by repairing specific tissues or organs. Stem cell regenerative medicine has broad application prospects in the treatment of skeletal muscle diseases and other diseases that currently have no good treatment options. [0003] Stem cells are primitive undifferentiated cells that have the ability to differentiate into other cell types. According to different sources, stem cells can be divided into pluripotent stem cells and stem cells from mature tissues. Pluripotent ste...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N5/10C12N15/85
CPCC07K14/435C12N5/0658C12N15/85C12N2510/00
Inventor 徐秀琴韩月
Owner XIAMEN UNIV