Method for acquiring stem cell-derived skeletal muscle cells based on Rbm24 gene
A skeletal muscle cell and rbm24 technology, applied in the field of stem cell regenerative medicine and medicine, can solve the problems of skeletal muscle-like cell viability and efficiency to be improved, and achieve the effect of solving the problem of high efficiency and effectiveness and widely used in large quantities
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0049] The present invention will be further described below in conjunction with specific examples.
[0050] Cloning and vector construction of Rbm24 gene:
[0051] According to the gene sequence of Rbm24 in the GenBank database, design primers to amplify the upstream and downstream primers of the Rbm24 gene:
[0052] Upstream primer: 5'—CATATGATGCACACGACCCAGAAGGAC—3';
[0053] Downstream primer: 5'—ACTAGTCTATTGCATTCGGTCTGTCTGC—3';
[0054] The upstream and downstream primers contain restriction sites for XhoI and KpnI.
[0055] The Rbm24 gene PCR amplification reaction system is 50 μl, including: FastPfu Fly DNA Polymerase, FastPfu Fly Buffer, Primer, dNTPs, cDNA, etc. The reaction program is: 95°C for 2 min, 1 cycle; 95°C for 20 sec, 60°C for 20 sec, 72°C for 10 sec, 35 cycles; 72°C for 5 min, 1 cycle.
[0056] The PCR product was recovered and purified to obtain the Rbm 24 gene fragment, which was then cloned into the pcDNA3.1 eukaryotic expression vector to construct a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


