Unlock instant, AI-driven research and patent intelligence for your innovation.

Microalgae light-harvesting protein NoHLR1 gene and application thereof

A light protein and gene technology, applied in the field of genetic engineering

Active Publication Date: 2019-07-30
HAINAN UNIVERSITY
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

NoHLR1 is in the marine Nannochloropsis Nannochloropsisoceanica The light-harvesting protein cloned in , whose function and sequence were discovered and synthesized by the applicant for the first time, has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microalgae light-harvesting protein NoHLR1 gene and application thereof
  • Microalgae light-harvesting protein NoHLR1 gene and application thereof
  • Microalgae light-harvesting protein NoHLR1 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Preparation of Nannochloropsis mutants knocked out of light-harvesting protein NoHLR1

[0047] 1. Bacterial strains and their cultivation: Nannochloropsis grows in F2 solid medium and F2 liquid medium.

[0048] 2. The resistance gene tag method was used to construct a saturated mutant library of Nannochloropsis, using hygromycin resistance tags, bleomycin resistance tags, etc. According to molecular biology techniques familiar to those skilled in the art, the resistance tag is amplified, and the fragment containing the screening marker is cut with an appropriate restriction endonuclease, and Nannochloropsis is transformed.

[0049] 3. Electrotransform Nannochloropsis cells, and introduce the fragment containing the resistance tag into the cells. That is, 0.5 micrograms of linearized plasmid and 6 million algal cells were placed in a 0.2cm electroporation cell (Bio-Rad), and 2.2kV pulsed (Bio-Rad electroporation instrument, 50μF).

[0050] 4. According to the...

Embodiment 2

[0055] Example 2 Cloning of the light-harvesting protein NoHLR1 gene

[0056] 1. Extract the total RNA of Nannochloropsis and reverse transcribe to obtain the first strand of cDNA.

[0057] 2. Using the first strand of cDNA as a template and NoHLR1-F and NoHLR1-R as primers, the cDNA sequence of NoHLR1 gene was obtained by PCR amplification reaction.

[0058] The primer sequences are as follows:

[0059] NoHLR1-F: 5'-GACCTCTGAAGTTCCCATATGATGAAAGTCACCGCCGTGCTCT-3'

[0060] NoHLR1-R: 5'-CTGGGATCCCCCGGGCATATGTTAAGAGAAAAGGGGAACACCG-3'

[0061] Use 2×TaqPCCRMasterMix (Takara) for PCR amplification, the reaction system is: 2 μL of cDNA template, 1 μL of primers F and R (10 μmol / L), 25 μL of 2×PCRMasterMix, add ddH 2 0 to 50 μL.

[0062] The PCR amplification program was: denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 90 s, extension at 72°C for 2 min, a total of 35 cycles; and finally extension at 72°C for 10 min.

[0063] 3. After the ampl...

Embodiment 3

[0065] Expression analysis of embodiment 3 NoHLR1 gene when subjected to high light stress

[0066] Fluorescent quantitative PCR was used to detect the expression of NoHLR1 gene in Nannochloropsis after high light treatment.

[0067] High-light treatment: Dark-adapt the algae cells overnight, then place them in a light incubator for high-light treatment, and collect samples continuously for 48 hours.

[0068] According to the NoHLR1 gene sequence, the following fluorescent quantitative PCR detection primers were designed:

[0069] NoHLR1-QF: 5'-GGACCAGGTCGCCAACCTCAAAT-3'

[0070] NoHLR1-QR: 5'-TCGGACTTGCCCTTGCTAAA-3'.

[0071] Actin-F: GCCGTTATTGGATGGATATG

[0072] Actin-R: ACAACAACTCTCCTTCACA

[0073] Actin was used as an internal reference gene. QuantStudio™qPCR fluorescent quantitative PCR instrument was used to perform fluorescent quantitative PCR, and the reaction program was: 95°C pre-denaturation for 30s; 94°C for 5s, 60°C for 20s, 72°C for 20s, and 45 cycles. Aft...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microalgae light-harvesting protein NoHLR1 gene and application thereof, and belongs to the field of stress resisting physiology. The gene is a light-harvesting protein geneNoHLR1, the sequence of the gene is shown as SEQIDNO:1, function analysis of a nannochloropsis oculata mutant shows that the highlight resisting capacity and grease yield of a muton for knocking out the gene are remarkably improved, and the gene can be used for genetic improvement of microalgae, plants, crops and the like.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the microalgal light-harvesting protein NoHLR1 gene and its application. Background technique [0002] In higher plants, PSII is located inside the thylakoid membrane, and its main function is the photolysis of water and oxygen release. The PSII complex contains more than 25 different protein subunits and more than 50 cofactors, including the PSII reaction center (mainly D1, D2 proteins) and the light-harvesting antenna system LHCII of PSII. LHCII can be divided into inner light-harvesting antennas and outer light-harvesting antennas. Inner light-harvesting antennas (core antenna proteins) are mainly CP43 and CP47. There are four main types of outer light-harvesting antennas: LHCIIa (Lhcb4, also known as CP29), LHCIIb (Lhcb1+2+3), LHCIIc (Lhcb5, also known as CP26) and LHCIId (Lhcb6, also known as CP24). They all contain three transmembrane helices with a molecular ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/405C12N15/31C12N15/82C12N1/13C12N15/80A01H5/00C12R1/89
CPCC07K14/405C12N15/80C12N15/8271
Inventor 路延笃吴丹
Owner HAINAN UNIVERSITY