Recombinant vector and expression method of potato aphid effect protein Me10 gene

A technology of effector proteins and recombinant vectors, applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, animal/human peptides, etc., can solve the problems of low success rate and cumbersome steps

Inactive Publication Date: 2019-08-13
GUIZHOU UNIV
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method has cumbersome steps and a low success rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector and expression method of potato aphid effect protein Me10 gene
  • Recombinant vector and expression method of potato aphid effect protein Me10 gene
  • Recombinant vector and expression method of potato aphid effect protein Me10 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Construction and Identification of Recombinant Vector of Potato Aphid Effector Protein Me10 Gene

[0030] 1. Extract potato RNA and reverse transcribe cDNA

[0031] The potato aphid tissue was taken, and the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was obtained by reverse transcription with a reverse transcription kit (Promega).

[0032] 2. Using cDNA as a template to amplify the Me10 gene;

[0033] Primers were designed to amplify the Me10 gene using cDNA as a template. The nucleotide sequence of the Me10 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the Me10 gene is shown in SEQ ID NO.2.

[0034] Primers are as follows:

[0035] Upstream primer: Me10-F: GC GAATTC ATGCAATCAATACAACCATTAATA is underlined as the BamHI restriction site;

[0036] Downstream primer: Me10-R:CG CTCGAG TTATGCTCCAACGACTGTTGGT underlined is the XhoI...

Embodiment 2

[0043] Example 2: Induced expression of Me10 protein

[0044] 1. Obtain the recombinant prokaryotic expression strain of Me10

[0045]The single clone successfully sequenced in Example 1 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - Extract the Me10 recombinant expression vector, take the recombinant expression vector and transform Escherichia coli BL21(DE3), Rosetta(DE3), BL21(DE3)pLysS strains, and detect the expression of Me10 protein.

[0046] 2. Cultivate the activated strain overnight

[0047] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3) strains to 50ug / mL kanamycin liquid medium, transfer Rosetta(DE3), BL21(DE3)pLysS strains to 50ug / mL kanamycin+50ug / mL chlorine The activated strain was cultured overnight at 37°C and 200 rpm in a mycin liquid medium.

[0048] 3. Induced expression

[0049] The activate...

Embodiment 3

[0056] Example 3: Verification of Me10 protein-induced expression conditions

[0057] 1. Obtain the recombinant expression strain of Me10

[0058] The single clone successfully sequenced in Example 1 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a -Me10 recombinant expression vectors were extracted, and the recombinant expression vectors were transformed into Escherichia coli BL21(DE3), Rosetta(DE3), BL21(DE3)pLysS strains respectively, and spread on plates containing 50ug / mL kanamycin (Rosetta(DE3) The strain needs to be supplemented with 50ug / mL chloramphenicol) for overnight culture at 37°C, pick a single colony and inoculate it into a liquid medium containing the corresponding antibiotic, culture overnight at 37°C, 200rpm, add sterilized 50% Glycerol, mixed evenly, and frozen in a -80°C refrigerator to obtain a prokaryotic expression strain expressing Me10.

[0059] 2. Determination of Me10 gene ind...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant vector of a potato aphid effect protein Me10 gene, and further discloses an expression method of the potato aphid effect protein Me10 gene. According to the recombinant vector and expression method of the potato aphid effect protein Me10 gene. The prokaryotic expression vector of the potato aphid effect protein Me10 gene is constructed, a series of optimization is carried out aiming at the protein expression condition, and finally, an Me10 soluble protein is obtained. The result lays a foundation for further study of protein crystal structures and biological characteristics, provides an idea for development of pesticides with Mp1 as a target, and then provides a basis for prevention and control of potato aphids.

Description

technical field [0001] The invention relates to a recombinant vector and an expression method of a potato aphid effector protein Me10 gene, belonging to the field of biotechnology. Background technique [0002] Potato is an important economic crop. With the rapid growth of potato production, the control of potato diseases becomes more and more important. Among potato diseases, some viral diseases of potato are an important part. Viral diseases cause serious degradation of potato varieties. According to investigations and studies, some viral diseases can cause 30% to 50% yield reduction, while aphids often spread in the potato field through multiple viruses, causing more serious losses, up to 80%. %. Therefore, the control of aphids should be an important part of virus control. [0003] The occurrence and prevalence of insect-borne diseases depend on the interaction between virus-insect-plant. In the game of defense and counter-defense between plants and herbivorous insec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/66C07K14/435
CPCC12N15/70C12N15/66C07K14/43563
Inventor谢鑫蒋君梅李向阳任明见孙涛
OwnerGUIZHOU UNIV