Recombinant vector and expression method of potato aphid effect protein Me10 gene
A technology of effector proteins and recombinant vectors, applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, animal/human peptides, etc., can solve the problems of low success rate and cumbersome steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: Construction and Identification of Recombinant Vector of Potato Aphid Effector Protein Me10 Gene
[0030] 1. Extract potato RNA and reverse transcribe cDNA
[0031] The potato aphid tissue was taken, and the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was obtained by reverse transcription with a reverse transcription kit (Promega).
[0032] 2. Using cDNA as a template to amplify the Me10 gene;
[0033] Primers were designed to amplify the Me10 gene using cDNA as a template. The nucleotide sequence of the Me10 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the Me10 gene is shown in SEQ ID NO.2.
[0034] Primers are as follows:
[0035] Upstream primer: Me10-F: GC GAATTC ATGCAATCAATACAACCATTAATA is underlined as the BamHI restriction site;
[0036] Downstream primer: Me10-R:CG CTCGAG TTATGCTCCAACGACTGTTGGT underlined is the XhoI...
Embodiment 2
[0043] Example 2: Induced expression of Me10 protein
[0044] 1. Obtain the recombinant prokaryotic expression strain of Me10
[0045]The single clone successfully sequenced in Example 1 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - Extract the Me10 recombinant expression vector, take the recombinant expression vector and transform Escherichia coli BL21(DE3), Rosetta(DE3), BL21(DE3)pLysS strains, and detect the expression of Me10 protein.
[0046] 2. Cultivate the activated strain overnight
[0047] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3) strains to 50ug / mL kanamycin liquid medium, transfer Rosetta(DE3), BL21(DE3)pLysS strains to 50ug / mL kanamycin+50ug / mL chlorine The activated strain was cultured overnight at 37°C and 200 rpm in a mycin liquid medium.
[0048] 3. Induced expression
[0049] The activate...
Embodiment 3
[0056] Example 3: Verification of Me10 protein-induced expression conditions
[0057] 1. Obtain the recombinant expression strain of Me10
[0058] The single clone successfully sequenced in Example 1 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a -Me10 recombinant expression vectors were extracted, and the recombinant expression vectors were transformed into Escherichia coli BL21(DE3), Rosetta(DE3), BL21(DE3)pLysS strains respectively, and spread on plates containing 50ug / mL kanamycin (Rosetta(DE3) The strain needs to be supplemented with 50ug / mL chloramphenicol) for overnight culture at 37°C, pick a single colony and inoculate it into a liquid medium containing the corresponding antibiotic, culture overnight at 37°C, 200rpm, add sterilized 50% Glycerol, mixed evenly, and frozen in a -80°C refrigerator to obtain a prokaryotic expression strain expressing Me10.
[0059] 2. Determination of Me10 gene ind...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


