Preparation method of DNA nanorobot drug-carrying system and DNA nanorobot drug-carrying system acquired via same

A nano-robot and system technology, which can be used in pharmaceutical formulations, medical preparations with non-active ingredients, and medical preparations containing active ingredients, etc., can solve problems such as uncontrolled release process, and achieve broad application prospects and good biological safety. , the effect of high stability

Active Publication Date: 2019-08-16
SHANGHAI INST OF APPLIED PHYSICS - CHINESE ACAD OF SCI
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the problem that the DNA nanostructure in the prior art cannot control the release process when used as a drug carrier, the present invention provides a preparation method of a DNA nanorobot drug-carrying system and a DNA nanorobot drug-carrying system obtained therefrom

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of DNA nanorobot drug-carrying system and DNA nanorobot drug-carrying system acquired via same
  • Preparation method of DNA nanorobot drug-carrying system and DNA nanorobot drug-carrying system acquired via same
  • Preparation method of DNA nanorobot drug-carrying system and DNA nanorobot drug-carrying system acquired via same

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0060] Example 1 Operation in Living Cells of Intelligent DNA Nanorobot Using DNA Single Strand as Key

[0061] The preparation method of the DNA nanorobot drug-carrying system according to the present invention firstly includes providing multiple single-stranded DNAs.

[0062] In this embodiment, 20 oligonucleotide sequences were synthesized by Shanghai Sangong Company, the nucleotide sequences of which are shown in SECQ ID NO:1-SECQ ID NO:20 respectively, wherein, 3 of SECQ ID NO:7 The first chain GGGCG with 5 bases at the 'end, the second chain CGGCC with 5 bases at the 3' end of SECQ ID NO:8, the third chain with 5 bases at the 3' end of SECQ ID NO:17 The chain TTGGA, SECQ ID NO: 18 has a fourth chain CGTTAT of 5 bases at the 3' end.

[0063] Specifically, from the 5' end to the 3' end,

[0064] SECQ ID NO:1(6-HB-1):

[0065] CAGTTGACTGCTAGTACCTGAGCACTGAATGCGATGTAGAAGTAGCTCTGCTCCATC;

[0066] SECQ ID NO:2(6-HB-2):

[0067] CGACTTGATGGAGCAGACCTATCGTCAC;

[0068] SECQ ...

example 2

[0168] Example 2 Operation of a DNA nanorobot using the ATP molecule in the cell as the key

[0169] Only the parts different from Example 1 will be described below, and the same parts as Example 1 will not be repeated.

[0170] Four oligonucleotide sequences were synthesized by Shanghai Shenggong Company, and their nucleotide sequences are shown in SECQ ID NO: 31-SECQ ID NO: 34, wherein, SECQ ID NO: 31 has an ATP aptamer sequence Partially complementary sequences, SECQ ID NO: 32 has a DNA aptamer sequence that binds to ATP molecules, SECQ ID NO: 33 has a DNA aptamer sequence that binds to ATP molecules, and SECQ ID NO: 34 has a Cy5 modification.

[0171] Specifically, from the 5' end to the 3' end,

[0172] SECQ ID NO: 31 (6-HB-3-ATP):

[0173] AGGCAGATACGAAGAGCGTGGACCCGTCGTAGATAGTTCTGGACCCACGCTAGACAC

[0174] SECQ ID NO: 32 (6-HB-17-ATP):

[0175] TGGAAGGAGGCGTTATGAGGGGGTCCA CTGGCATGTGATACATACACTGGTTGGA

[0176] SECQ ID NO: 33 (6-HB-18-ATP):

[0177] TGGAAGGAGGCGTT...

example 3

[0192] Example 3 Operation of a DNA nanorobot using cell surface nucleolin as a key

[0193] Only the parts different from Example 1 will be described below, and the same parts as Example 1 will not be repeated.

[0194]Four oligonucleotide sequences were synthesized by Shanghai Shenggong Company, and their nucleotide sequences are respectively shown in SECQ ID NO:35-SECQ ID NO:38, wherein SECQ ID NO:35 has an adapter with nucleolin SECQ ID NO:36 has a DNA aptamer sequence that binds to nucleolin protein, SECQ ID NO:37 has a DNA aptamer sequence that binds to nucleolin protein, SECQ ID NO: 38 is modified with Cy5.

[0195] Specifically, from the 5' end to the 3' end,

[0196] SECQ ID NO:35(6-HB-3-NCL):

[0197] AGGCAGATACGAAGAGCGCCACCACGTCGTAGATAGTTCCCACCACACGCTAGACAC

[0198] SECQ ID NO: 36 (6-HB-17-NCL):

[0199] GGTGGTGGTGGTTGTGGTGGTGGTGG CTGGCATGTGATACATACACTGGTTGGA

[0200] SECQ ID NO: 37 (6-HB-18-NCL):

[0201] GGTGGTGGTGGTTGTGGTGGTGGTGG GGCTCATGCAATACGGTCGTTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method of a DNA nanorobot drug-carrying system. The preparation method comprises connecting at least one single-chain DNA with a hydrophobic drug molecule through a covalent bond to form a covalent connection product; adding the covalent connection product and residual single-chain DNAs into a first buffer solution containing magnesium ions, allowing to reactto assemble a complex of DNA nanostructure and hydrophobic drug molecule, allowing the residual single-chain DNAs and the single-chain DNA of the covalent connection product to form a DNA nanostructure having a lock through self-assembly, with the hydrophobic drug molecule locked inside the DNA nanostructure; providing a key, and allowing the key to cooperate with the lock to expose the hydrophobic drug molecule from the nanostructure, so that the DNA nanorobot drug-carrying system is provided. The invention also provides a DNA nanorobot drug-carrying system acquired via the preparation method. The DNA nanorobot drug-carrying system is suitable for targeted delivery and controlled release of drug molecules in live cells and has a good application prospect in the intelligent diagnosis andtreatment of major diseases.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to a preparation method of a DNA nanorobot drug-carrying system and a DNA nanorobot drug-carrying system obtained therefrom. Background technique [0002] The 2016 Nobel Prize in Chemistry was awarded to three professors, Bernard L. Feringa, Jean-Pierre Sauvage and J. Fraser Stoddart, in recognition of their outstanding contributions in the field of molecular machines. Molecular machines are assembled from a series of molecular structural units, which can generate mechanical motion under external stimuli. Among them, intelligent molecular machines assembled by nucleic acid or protein show unique advantages in tumor diagnosis and treatment due to their unique topological structure, dynamic change characteristics, and rich sources of external stimuli. [0003] DNA can not only be used as a carrier of genetic information, self-assembled DNA nanostructures formed by complem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K47/54A61K47/26A61K31/537A61P35/00
CPCA61K47/549A61K47/26A61K31/537A61P35/00
Inventor樊春海王丽华赵彦李凡
OwnerSHANGHAI INST OF APPLIED PHYSICS - CHINESE ACAD OF SCI