Preparation method of DNA nanorobot drug-carrying system and DNA nanorobot drug-carrying system acquired via same
A nano-robot and system technology, which can be used in pharmaceutical formulations, medical preparations with non-active ingredients, and medical preparations containing active ingredients, etc., can solve problems such as uncontrolled release process, and achieve broad application prospects and good biological safety. , the effect of high stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0060] Example 1 Operation in Living Cells of Intelligent DNA Nanorobot Using DNA Single Strand as Key
[0061] The preparation method of the DNA nanorobot drug-carrying system according to the present invention firstly includes providing multiple single-stranded DNAs.
[0062] In this embodiment, 20 oligonucleotide sequences were synthesized by Shanghai Sangong Company, the nucleotide sequences of which are shown in SECQ ID NO:1-SECQ ID NO:20 respectively, wherein, 3 of SECQ ID NO:7 The first chain GGGCG with 5 bases at the 'end, the second chain CGGCC with 5 bases at the 3' end of SECQ ID NO:8, the third chain with 5 bases at the 3' end of SECQ ID NO:17 The chain TTGGA, SECQ ID NO: 18 has a fourth chain CGTTAT of 5 bases at the 3' end.
[0063] Specifically, from the 5' end to the 3' end,
[0064] SECQ ID NO:1(6-HB-1):
[0065] CAGTTGACTGCTAGTACCTGAGCACTGAATGCGATGTAGAAGTAGCTCTGCTCCATC;
[0066] SECQ ID NO:2(6-HB-2):
[0067] CGACTTGATGGAGCAGACCTATCGTCAC;
[0068] SECQ ...
example 2
[0168] Example 2 Operation of a DNA nanorobot using the ATP molecule in the cell as the key
[0169] Only the parts different from Example 1 will be described below, and the same parts as Example 1 will not be repeated.
[0170] Four oligonucleotide sequences were synthesized by Shanghai Shenggong Company, and their nucleotide sequences are shown in SECQ ID NO: 31-SECQ ID NO: 34, wherein, SECQ ID NO: 31 has an ATP aptamer sequence Partially complementary sequences, SECQ ID NO: 32 has a DNA aptamer sequence that binds to ATP molecules, SECQ ID NO: 33 has a DNA aptamer sequence that binds to ATP molecules, and SECQ ID NO: 34 has a Cy5 modification.
[0171] Specifically, from the 5' end to the 3' end,
[0172] SECQ ID NO: 31 (6-HB-3-ATP):
[0173] AGGCAGATACGAAGAGCGTGGACCCGTCGTAGATAGTTCTGGACCCACGCTAGACAC
[0174] SECQ ID NO: 32 (6-HB-17-ATP):
[0175] TGGAAGGAGGCGTTATGAGGGGGTCCA CTGGCATGTGATACATACACTGGTTGGA
[0176] SECQ ID NO: 33 (6-HB-18-ATP):
[0177] TGGAAGGAGGCGTT...
example 3
[0192] Example 3 Operation of a DNA nanorobot using cell surface nucleolin as a key
[0193] Only the parts different from Example 1 will be described below, and the same parts as Example 1 will not be repeated.
[0194]Four oligonucleotide sequences were synthesized by Shanghai Shenggong Company, and their nucleotide sequences are respectively shown in SECQ ID NO:35-SECQ ID NO:38, wherein SECQ ID NO:35 has an adapter with nucleolin SECQ ID NO:36 has a DNA aptamer sequence that binds to nucleolin protein, SECQ ID NO:37 has a DNA aptamer sequence that binds to nucleolin protein, SECQ ID NO: 38 is modified with Cy5.
[0195] Specifically, from the 5' end to the 3' end,
[0196] SECQ ID NO:35(6-HB-3-NCL):
[0197] AGGCAGATACGAAGAGCGCCACCACGTCGTAGATAGTTCCCACCACACGCTAGACAC
[0198] SECQ ID NO: 36 (6-HB-17-NCL):
[0199] GGTGGTGGTGGTTGTGGTGGTGGTGG CTGGCATGTGATACATACACTGGTTGGA
[0200] SECQ ID NO: 37 (6-HB-18-NCL):
[0201] GGTGGTGGTGGTTGTGGTGGTGGTGG GGCTCATGCAATACGGTCGTTG...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com