Method for enriching target DNA fragments by multiplex PCR

A technology of target fragments and fragments, applied in DNA/RNA fragments, recombinant DNA technology, DNA preparation, etc., can solve problems such as high cost, large amount of starting genomic DNA, and reduced sequencing costs

Active Publication Date: 2019-08-20
INST OF BOTANY CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, MIP and DNA chip technologies are relatively complex, suitable for the enrichment of target fragments in a large number of groups, the cost is high, and the amount of starting genomic DNA required is large
And these methods all need to establish a high-quality sample library, thereby increasing the cost of the experiment
PCR technology is a method with good selectivity and low technical requirements, although nucleotide mutations generated during amplification will be amplified in Illumina’s sample pretreatment, resulting in too many false positive results; but with With the continuous development of next-generation sequencing technology (for example, Illumina GA updated 6 generations between 2006-2012, and Illumina Hiseq updated 7 generations between 2010-2015), the cost of sequencing is constantly decreasing, and the length of sequencing is constantly increasing. increase, then increasing the sequencing depth is sufficient to resolve the defect of selective enrichment due to PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for enriching target DNA fragments by multiplex PCR
  • Method for enriching target DNA fragments by multiplex PCR
  • Method for enriching target DNA fragments by multiplex PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0111] Embodiment 1, utilize multiplex PCR to enrich the target segment of rice genomic DNA

[0112] 1.1 Experimental materials

[0113] Genomic DNA of Zhonghua 11 (ZH11). Genomic DNA was extracted using the standard CTAB method, and the final concentration was diluted and quantified to 50ng / μL.

[0114] 1.2 Preparation of multiplex PCR primers

[0115] Two rounds of PCR primers were designed and each primer was synthesized.

[0116] Design of the first round of PCR primers (1st PCR): primers were designed for 24 known SNP sites of rice, and the size of the genome amplified by the primers of each site was 200-250bp. The 5' end of the forward primer at each site all contains a common sequence of 21bp (this sequence is an overlapping sequence (overlap) in the Illumina sequencing primer, TACACGACGCTCTTCCGATCT), and the rest is used to identify rice genomic DNA; The 5' ends all contain a 21bp common sequence (the sequence is an overlapping sequence (overlap) in the Illumina se...

Embodiment 2

[0181]Example 2, Optimization of the method for multiple PCR enrichment of target fragments

[0182] It can be concluded from the results of Example 1 that the more the number of primers increases, the worse the effect of enriched target fragments is, especially the homogeneity among the enriched target fragments is very poor. In order to solve the problem of the uniformity of the target fragment obtained by enrichment, the inventors tested the effect of using 5 DNA polymerases and 6 primer pairs to amplify the target fragment by multiplex PCR.

[0183] 2.1 Experimental materials

[0184] Genomic DNA of Zhonghua 11 (ZH11). Genomic DNA was extracted using the standard CTAB method, and the final concentration was diluted and quantified to 50ng / μL.

[0185] 2.2 Preparation of multiplex PCR primers

[0186] In order to reduce the amount of primers, three rounds of PCR amplification were used in this embodiment, three rounds of PCR primers were designed, and each primer was synt...

Embodiment 3

[0272] Embodiment 3, optimization of multiplex PCR

[0273] 1. Analysis of Factors Affecting Multiplex PCR

[0274] In order to achieve specific enrichment of more target fragments in a PCR reaction system, the inventors used different DNA sequence analysis software (DNAMAN software and Oligo7 software) to analyze the characteristics of the primers, specifically for the 3' end of each primer The number of 3 nucleotides or 4 nucleotides complementary to the 5' end and other primers in the same PCR reaction system was counted, and the complementarity between the primers was counted again using the PCR Primer Stats and Multiple Primer Analyzer websites , the analysis objects are 57 pairs of primer sequences composed of Table 2.1 and Table 2.2 in Example 2, and the indicators analyzed by each software and website are specifically shown in Table 3.1.

[0275] Using DNAMAN software and Oligo7 software to count the factors affecting PCR amplification of each pair of primers (Table 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for enriching target DNA fragments by multiple PCR. The method for enriching target DNA fragments disclosed by the invention includes: carrying out multiplex PCR for enriching target DNA fragments by using a complete set of primers meeting the following conditions: factor J of each primer pair < 50% and at most one factor of nine factors is not in the standard range; the standard ranges of the nine factors are: 35% <= factor A <= 60%; 68 DEG C <= factor B <= 79 DEG C; 30% <= factor C <= 70%; 30% <= factor D <= 70%; 15 kcal / mol <= absolute value of factor E <= 70 kcal / mol; absolute value of factor F < 100 kcal / mol; absolute value of factor G < 100 kcal / mol; 4 kcal / mol <= absolute value of factor H <= 10 kcal / mol; and factor I < 100 DEG C. The method of the invention can be used to successfully enrich target DNA fragments in genome.

Description

technical field [0001] The invention relates to a method for enriching target DNA fragments by multiplex PCR in the field of biotechnology. Background technique [0002] High-throughput sequencing technology (High-throughput sequencing), also known as next-generation sequencing technology (NextGeneration Sequencing, NGS), is a series of sequencing technologies emerging after 2004, which can parallelize a large number (hundreds of thousands to millions) of DNA molecules at a time. Perform sequence determination. Genome de novo sequencing, genome resequencing, transcriptome sequencing, epigenetics, single nucleotide polymorphism (Single Nucleotide Polymorphism, SNP) development, etc., will make genomics a routine method for studying biological problems , become a powerful tool for people to study molecular biology, molecular genetics and so on. [0003] Among various next-generation sequencing technologies, the Genome Analyzer (GA) developed by Illumina was established by So...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6806C12N15/11C12N15/10C40B50/06C12Q1/6869C12Q1/6858C12Q1/6895
CPCC12Q1/6806C12Q1/6858C12Q1/6869C12Q1/6895C12Q2600/156C12Q2600/16C40B50/06C12Q2531/113C12Q2537/143
Inventor漆小泉张英春池旭段礼新
OwnerINST OF BOTANY CHINESE ACAD OF SCI