Application of migratory locust Knickkopf 3-5' gene dsRNA in pest control

A technology of migratory locusts and genes, applied in the direction of DNA/RNA fragments, applications, genetic engineering, etc., can solve the problems of slow effect, damage to the agricultural ecological environment, and long killing time, and achieve a high lethal effect

Active Publication Date: 2019-08-27
SHANXI UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Long-term large-scale application of pesticides will seriously damage the agricultural ecological environment and eventually endanger human health. At the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of migratory locust Knickkopf 3-5' gene dsRNA in pest control
  • Application of migratory locust Knickkopf 3-5' gene dsRNA in pest control
  • Application of migratory locust Knickkopf 3-5' gene dsRNA in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] Example 1: Acquisition of the full-length cDNA of the migratory locust Knickkopf 3-5' gene

[0015] 1. Search from the migratory locust transcriptome database, and then use the NCBI Blastx online software to analyze, and determine to obtain a migratory locust Knickkopf 3-5' gene sequence.

[0016] 2. The upstream primer ATGGAGGCCCGCACGTGCA (SEQ ID NO: 2) and the downstream primer CTACTTCTGCTGCTGGTAGT (SEQ ID NO: 3) were respectively designed using primer premier 5.0 software. The designed primers were sent to Sangon Bioengineering (Shanghai) Co., Ltd. for synthesis.

[0017] 3. Select the 5th instar nymphs of migratory locusts with uniform size and good growth condition, peel off their epidermis quickly, and store them in liquid nitrogen, then extract RNA according to the method of TaKaRa Trizol kit, and use M-MLV reverse transcriptase to extract RNA. Reverse transcribed into the first-strand cDNA as the template required for the amplification of the full-length sequen...

Embodiment 2

[0019] Embodiment 2: Obtaining of dsRNA of migratory locust Knickkopf 3-5' gene fragment

[0020] 1. Based on the nucleotide sequence SEQ ID NO: 1 of the migratory locust Knickkopf 3-5' gene, use primerpremier5.0 software to design a pair of upstream and downstream primers required for the synthesis of dsRNA, taatacgactcactatagggCGTCTCGCGGTTCCTTCCGGTTC (SEQ ID NO: 4) and taatacgactcactatagggTACTTCTGCTGCTGGTAGTTTGC (SEQ ID NO :5), the part in italics is the T7 promoter. The primers were sent to Shanghai Sangon Bioengineering Co., Ltd. for synthesis.

[0021] 2. Using the above primers and the full-length plasmid of migratory locust Knickkopf 3-5' as raw materials, PCR amplification was performed to obtain a 383bp fragment. Its nucleotide sequence is the sequence shown in SEQ ID NO: 6, and both ends contain T7 promoters. After the product was purified by Gel Extraction Kit (Omega), it was quantified using NaNoDrop 2000 (Thermo scientific) and used as a template for dsRNA synth...

Embodiment 3

[0023] Embodiment 3: The dsRNA synthesized by the migratory locust Knickkopf 3-5' gene fragment is lethal to migratory locusts

[0024] 1. Injection of dsRNA

[0025]100 well-developed, uniform-sized migratory locust fifth-instar first-day nymphs were selected for dsRNA injection. The worms injected with dsGFP were set as the control group, and the worms injected with dsLmKnk3-5' were set up as the treatment group. The control group and the treatment group were injected with 50 worms, half male and half male. 20 μg of dsRNA was injected into the locust body cavity along the second abdominal segment of the migratory locust abdomen with a micro-injector. After the injection, the two groups of nymphs were respectively placed in sarongs of 30cm × 30cm, given the same conditions (light: dark time=14h:10h, temperature 30±2°C, humidity 60%) to raise, and a sufficient amount was supplied every day. fresh wheatgrass and wheat bran.

[0026] 2. Detection of mRNA expression of migrato...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides application of a migratory locust Knickkopf 3-5' gene dsRNA in pest control, discloses a Knickkopf 3-5' gene having a nucleotide sequence as shown in SEQ ID NO: 1 and further discloses a migratory locust Knickkopf 3-5' gene fragment and dsRNA thereof, and the nucleotide sequence of the gene fragment is as shown in SEQ ID NO: 6. The designed and synthesized dsRNA is injectedinto a migratory locust, and the migratory locust has two phenotypes: difficult molting and death and adult wing curling, and half of the adults with curly wings die within seven days, the phenotype rate reaching 90%. The Knickkopf 3-5' gene screened and obtained by the invention can be used as an important molecular target for migratory locust control, and provides a new way for green pest control.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of migratory locust epidermal protein gene Knickkopf 3-5' (LmKnk3-5') and its dsRNA (dsLmKnk3-5') in pest control. Background technique [0002] Agricultural pests are an important factor restricting the high yield of crops in our country. At present, the main method of preventing and controlling agricultural pests in our country is the chemical method, that is, the use of chemical insecticides and pesticides. Long-term large-scale application of pesticides will seriously damage the agricultural ecological environment and eventually endanger human health. At the same time, pesticides also have a greater impact on non-target organisms, while traditional biological control methods take a long time to kill insects and have slow effects. Therefore, there is an urgent need to develop environmentally friendly green pest control technologies. [0003] The RNA interference ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C12N15/113A01N57/16A01P7/04
CPCC07K14/43563C12N15/113A01N57/16C12N2310/14Y02A40/146
Inventor 张建珍张睿赵小明刘晓健马恩波
Owner SHANXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap