Fusion protein, cell exosome and tumor vaccine, and application thereof
A fusion protein and tumor vaccine technology, applied in the field of vaccine preparation, can solve the problem of no tumor vaccine for esophageal cancer, and achieve remarkable results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Discovery of ASTN2-PAPPA fusion protein
[0028] Experimental method: The pathological tissue samples of tumor patients were collected, and through high-throughput sequencing technology, it was found that in malignant tumors, ASTN2 gene (ID: 23245) and PAPPA gene (ID: 5069) were fused to form a new fusion protein ASTN2 -PAPPA, and the site of fusion and its sequence were identified.
[0029] (1) The nucleotide sequence of the fusion protein ASTN2-PAPPA is as follows:
[0030]GATTGATCTACCATGGACTACAAAGACGATGACGACAAGGGGATCATGGCCGCCGCCGGCGCCCGGCTCAGCCCCGGCCCCGGCTCGGGGCTCCGGGGGCGGCCGAGGCTCTGCTTCCACCCGGGGCCGCCGCCACTGCTGCCGCTGCTGCTGCTGTTCCTGCTCCTGCTGCCGCCGCCGCCGCTGCTGGCCGGCGCCACCGCCGCTGCCTCGCGGGAGCCCGACAGCCCGTGCCGGCTGAAGACCGTCACGGTGTCCACACTGCCCGCCCTGCGGGAGAGCGACATCGGCTGGAGCGGCGCCCGCGCCGGGGCCGGGGCTGGGACCGGGGCCGGAGCCGCCGCCGCCGCCGCGTCCCCGGGCTCTCCTGGCTCTGCCGGCACCGCCGCCGAGTCGCGCCTCCTGCTCTTTGTGCGTAACGAGCTGCCGGGGCGCATCGCGGTGCAGGACGACCTGGACAACACCGAGCTGCCCTTCTTCACCCTGGAGATGTC...
Embodiment 2
[0035] Determination of Example 2 Antigenic Peptide Sequence
[0036] Seven polypeptides on the ASTN2-PAPPA protein in Example 1 that may mediate T cell-specific immune responses were obtained through bioinformatics prediction analysis, as shown in Table 1 below.
[0037] Table 1. HLA-binding peptides predicted by NetMHCpan 4.0 server
[0038]
[0039] *Binding score estimated using NetMHCpan 4.0 server ( http: / / www.cbs.dtu.dk / services / NetMHCpan / ).
[0040] Among them, HLA (human leukocyte antigen) represents human leukocyte antigen.
Embodiment 3
[0041] Example 3 ASTN2-PAPPA is an effective neoantigen for the development of specific esophageal squamous cell carcinoma vaccine
[0042] 1. Prepare ASTN2-PAPPA polypeptide and immunize mice: Take 100ug of 7 antigen polypeptides (synthesized by Wuhan Aibotai Company) in Example 2, use vesiculo-stomatitis virusnucleoprotein, VSV-NP52-59 as negative control, tyrosinaserelatedprotein 2, Trp2180 -188 is a positive control (both VSV-NP52-59 and Trp2180-188 are purchased from the market), dissolved in PBS with 50ug poly(I:C) (InvivoGen, USA) to make the total volume 200ul, and injected into C57BL / 6 (H-2b) Mice (6-8 weeks old female) were subcutaneously subcutaneously on the back, and immunized again in the same way 7 days later. After 12 days, the mice were killed by dislocation of the neck, and subsequent treatments such as isolation of spleen T cells were performed.
[0043] 2. Extract mouse spleen lymphocytes: After taking blood from the eyeballs, the mice were killed by neck d...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap