Fusion protein, cell exosome and tumor vaccine, and application thereof

A fusion protein and tumor vaccine technology, applied in the field of vaccine preparation, can solve the problem of no tumor vaccine for esophageal cancer, and achieve remarkable results

Active Publication Date: 2019-09-03
张灏
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, there is currently no corresponding tumor vaccine for esophageal cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein, cell exosome and tumor vaccine, and application thereof
  • Fusion protein, cell exosome and tumor vaccine, and application thereof
  • Fusion protein, cell exosome and tumor vaccine, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Discovery of ASTN2-PAPPA fusion protein

[0028] Experimental method: The pathological tissue samples of tumor patients were collected, and through high-throughput sequencing technology, it was found that in malignant tumors, ASTN2 gene (ID: 23245) and PAPPA gene (ID: 5069) were fused to form a new fusion protein ASTN2 -PAPPA, and the site of fusion and its sequence were identified.

[0029] (1) The nucleotide sequence of the fusion protein ASTN2-PAPPA is as follows:

[0030]GATTGATCTACCATGGACTACAAAGACGATGACGACAAGGGGATCATGGCCGCCGCCGGCGCCCGGCTCAGCCCCGGCCCCGGCTCGGGGCTCCGGGGGCGGCCGAGGCTCTGCTTCCACCCGGGGCCGCCGCCACTGCTGCCGCTGCTGCTGCTGTTCCTGCTCCTGCTGCCGCCGCCGCCGCTGCTGGCCGGCGCCACCGCCGCTGCCTCGCGGGAGCCCGACAGCCCGTGCCGGCTGAAGACCGTCACGGTGTCCACACTGCCCGCCCTGCGGGAGAGCGACATCGGCTGGAGCGGCGCCCGCGCCGGGGCCGGGGCTGGGACCGGGGCCGGAGCCGCCGCCGCCGCCGCGTCCCCGGGCTCTCCTGGCTCTGCCGGCACCGCCGCCGAGTCGCGCCTCCTGCTCTTTGTGCGTAACGAGCTGCCGGGGCGCATCGCGGTGCAGGACGACCTGGACAACACCGAGCTGCCCTTCTTCACCCTGGAGATGTC...

Embodiment 2

[0035] Determination of Example 2 Antigenic Peptide Sequence

[0036] Seven polypeptides on the ASTN2-PAPPA protein in Example 1 that may mediate T cell-specific immune responses were obtained through bioinformatics prediction analysis, as shown in Table 1 below.

[0037] Table 1. HLA-binding peptides predicted by NetMHCpan 4.0 server

[0038]

[0039] *Binding score estimated using NetMHCpan 4.0 server ( http: / / www.cbs.dtu.dk / services / NetMHCpan / ).

[0040] Among them, HLA (human leukocyte antigen) represents human leukocyte antigen.

Embodiment 3

[0041] Example 3 ASTN2-PAPPA is an effective neoantigen for the development of specific esophageal squamous cell carcinoma vaccine

[0042] 1. Prepare ASTN2-PAPPA polypeptide and immunize mice: Take 100ug of 7 antigen polypeptides (synthesized by Wuhan Aibotai Company) in Example 2, use vesiculo-stomatitis virusnucleoprotein, VSV-NP52-59 as negative control, tyrosinaserelatedprotein 2, Trp2180 -188 is a positive control (both VSV-NP52-59 and Trp2180-188 are purchased from the market), dissolved in PBS with 50ug poly(I:C) (InvivoGen, USA) to make the total volume 200ul, and injected into C57BL / 6 (H-2b) Mice (6-8 weeks old female) were subcutaneously subcutaneously on the back, and immunized again in the same way 7 days later. After 12 days, the mice were killed by dislocation of the neck, and subsequent treatments such as isolation of spleen T cells were performed.

[0043] 2. Extract mouse spleen lymphocytes: After taking blood from the eyeballs, the mice were killed by neck d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a fusion protein, wherein the fusion protein has the amino acid sequence shown in SEQ ID NO.1 or has the coding sequence shown in SEQ ID NO.2. The invention also discloses a cell exosome and an application thereof, wherein the cell exosome contains the fusion protein; and the DC exosome vaccine is loaded with the ASTN2-PAPPA fusion protein or one of polypeptides and is a non-cellular cancer vaccine. The DEX vaccine combines the advantages of the DC vaccine and the unique advantages of the exosome. As a cancer vaccine, the DEX vaccine has a quite significant effect and can be used in cancer immunotherapy. In addition, the ASTN2-PAPPA is a brand new coding protein translated by fusion RNA, is specifically expressed in esophageal cancer, and plays a key role in the occurrence and development of esophageal cancer.

Description

technical field [0001] The invention relates to the technical field of vaccine preparation, in particular to a fusion protein, cell exosome and tumor vaccine and applications thereof. Background technique [0002] The occurrence and development of malignant tumors involves molecular mechanisms at many levels. Aberrant splicing of RNA is one of the key mechanisms. RNA splicing is a highly precise key step in the process of RNA processing, and any error may lead to abnormal expression and even disease. With the development of deep sequencing, transcriptomics and bioinformatics technology, a large number of products produced by abnormal RNA splicing have been discovered: fusion RNA and fusion protein. Unlike fusion genes, fusion RNA production does not involve chromosomal and DNA changes (including DNA insertions, amplifications, deletions, rearrangements, translocations). However, the fusion RNA can be translated into a fusion protein; the fusion protein translated from thi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K19/00C12N15/62C12N5/10A61K39/00A61P35/00
CPCC07K14/47A61K39/0011A61P35/00C07K2319/00A61K2039/53
Inventor 张灏
Owner 张灏
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap