Cryptosporidium multi-epitope gene fragment cpmcef and fusion protein and application thereof
A cryptosporidium and fusion protein technology, applied in the field of bioengineering, can solve problems such as the lack of research reports on cryptosporidium multi-epitope vaccines
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Cryptosporidium antigen T cell epitope prediction
[0047] Through literature search, potential candidate vaccine antigens of Cryptosporidium were collected, their GeneBank accession numbers were recorded, and related protein sequences were downloaded from NCBI.
[0048] Using offline and online epitope prediction servers, including DNAMAN, CTLPred, ProPred1, MAPPP, nHLAPred, BIMAS, LPPEP, SYMHC, NetMHC, MHCPred, Epitopebinding, MMPRED, PREDEP, T-epitope designer, PREDICT, SYFPEITHI, RANKPEP, MHCBench, ProPred, Epipredict, ProPred2, HLADR4Pred, HLADR4Pred, MHC2Pred, MHC-Thread, etc., predict the CTL and Th epitopes of the screened Cryptosporidium antigens, and the specific methods follow the relevant software instructions. The epitopes predicted by various software were sorted and scored, and a comprehensive analysis was performed according to the evaluation results of multiple software.
[0049] Results: From the literature reports, a total of 26 cryptospori...
Embodiment 2
[0050] Example 2 Design and synthesis of cryptosporidium multi-epitope gene fragment cpmcef
[0051] Among the obtained 361 epitopes, 10 epitopes with relatively high screening scores (see SEQ ID NO.1~SEQ ID NO.10) are connected in series, and the epitopes are linked by flexible amino acids, so that the 10 antigens can express Bits are spatially independent of each other and function independently. At the same time, protective bases, enzyme cleavage sites, kozac sequences, initiation codons, anti-dislocation protection bases GCT, stop codons, etc. are added to the 5' and 3' ends of the multi-epitope gene sequence respectively to form A Cryptosporidium multi-epitope gene fragment with a full length of 442bp and its nucleotide sequence is shown in SEQ ID NO.12. The gene fragment is named cpmcef. The sequence was synthesized by Huada Gene Co., Ltd. and connected to the pMD-18T vector, named pMD-cpmcef. The pMD-cpmcef recombinant vector is a cloning recombinant vector. The amino...
Embodiment 3
[0052] Example 3 Construction of recombinant plasmid for eukaryotic expression of cpmcef multi-epitope gene fragment of Cryptosporidium
[0053] (1) Construction of recombinant eukaryotic expression plasmid
[0054] According to the requirements of restriction sites and triplet codons on the multi-cloning site of the pVAX-1 expression vector, the upstream primer and downstream primer of the multi-epitope gene fragment cpmcef of Cryptosporidium were re-synthesized. The primers designed are as follows: cpmcef(e)F: CCGGAATTCCCGACCATGGCTATGAAATTGGATGAGGTTGTTG (SEQ ID NO. 13); cpmcef(e)R: CCCTCTAGATTATTCA TCCAAAGCAATATTTCTG (SEQ ID NO. 14). The pMD-cpmcef bacterial liquid was used as a template for PCR amplification. After 30 cycles of PCR amplification, the cpmcef(e) gene was obtained, and the size was in line with the prediction (see figure 1 ),
[0055] figure 1 Middle, M: 100bp DNA molecular weight standard; 1-2: cpmcef(e) PCR amplification product. The target gene fragmen...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


