Unlock instant, AI-driven research and patent intelligence for your innovation.

Cryptosporidium multi-epitope gene fragment cpmcef and fusion protein and application thereof

A cryptosporidium and fusion protein technology, applied in the field of bioengineering, can solve problems such as the lack of research reports on cryptosporidium multi-epitope vaccines

Active Publication Date: 2019-11-05
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is still a lack of research reports on cryptosporidium multi-epitope vaccines at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cryptosporidium multi-epitope gene fragment cpmcef and fusion protein and application thereof
  • Cryptosporidium multi-epitope gene fragment cpmcef and fusion protein and application thereof
  • Cryptosporidium multi-epitope gene fragment cpmcef and fusion protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Cryptosporidium antigen T cell epitope prediction

[0047] Through literature search, potential candidate vaccine antigens of Cryptosporidium were collected, their GeneBank accession numbers were recorded, and related protein sequences were downloaded from NCBI.

[0048] Using offline and online epitope prediction servers, including DNAMAN, CTLPred, ProPred1, MAPPP, nHLAPred, BIMAS, LPPEP, SYMHC, NetMHC, MHCPred, Epitopebinding, MMPRED, PREDEP, T-epitope designer, PREDICT, SYFPEITHI, RANKPEP, MHCBench, ProPred, Epipredict, ProPred2, HLADR4Pred, HLADR4Pred, MHC2Pred, MHC-Thread, etc., predict the CTL and Th epitopes of the screened Cryptosporidium antigens, and the specific methods follow the relevant software instructions. The epitopes predicted by various software were sorted and scored, and a comprehensive analysis was performed according to the evaluation results of multiple software.

[0049] Results: From the literature reports, a total of 26 cryptospori...

Embodiment 2

[0050] Example 2 Design and synthesis of cryptosporidium multi-epitope gene fragment cpmcef

[0051] Among the obtained 361 epitopes, 10 epitopes with relatively high screening scores (see SEQ ID NO.1~SEQ ID NO.10) are connected in series, and the epitopes are linked by flexible amino acids, so that the 10 antigens can express Bits are spatially independent of each other and function independently. At the same time, protective bases, enzyme cleavage sites, kozac sequences, initiation codons, anti-dislocation protection bases GCT, stop codons, etc. are added to the 5' and 3' ends of the multi-epitope gene sequence respectively to form A Cryptosporidium multi-epitope gene fragment with a full length of 442bp and its nucleotide sequence is shown in SEQ ID NO.12. The gene fragment is named cpmcef. The sequence was synthesized by Huada Gene Co., Ltd. and connected to the pMD-18T vector, named pMD-cpmcef. The pMD-cpmcef recombinant vector is a cloning recombinant vector. The amino...

Embodiment 3

[0052] Example 3 Construction of recombinant plasmid for eukaryotic expression of cpmcef multi-epitope gene fragment of Cryptosporidium

[0053] (1) Construction of recombinant eukaryotic expression plasmid

[0054] According to the requirements of restriction sites and triplet codons on the multi-cloning site of the pVAX-1 expression vector, the upstream primer and downstream primer of the multi-epitope gene fragment cpmcef of Cryptosporidium were re-synthesized. The primers designed are as follows: cpmcef(e)F: CCGGAATTCCCGACCATGGCTATGAAATTGGATGAGGTTGTTG (SEQ ID NO. 13); cpmcef(e)R: CCCTCTAGATTATTCA TCCAAAGCAATATTTCTG (SEQ ID NO. 14). The pMD-cpmcef bacterial liquid was used as a template for PCR amplification. After 30 cycles of PCR amplification, the cpmcef(e) gene was obtained, and the size was in line with the prediction (see figure 1 ),

[0055] figure 1 Middle, M: 100bp DNA molecular weight standard; 1-2: cpmcef(e) PCR amplification product. The target gene fragmen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cryptosporidium multi-epitope fusion protein. The cryptosporidium multi-epitope fusion protein comprises amino acid sequences formed by connecting epitope sequences shown inSEQ ID NO.1-10 in series in a random order. The invention further discloses a cryptosporidium multi-epitope gene fragment. The cryptosporidium multi-epitope gene fragment comprises a nucleotide sequence encoding the fusion protein. According to the cryptosporidium multi-epitope gene fragment, a recombinant protein obtained by prokaryotic expression, or a eukaryotic recombinant vector obtained by cloning into a eukaryotic vector has a good protective effect on cryptosporidium taisei infection in mice either by immunization alone or by adding allicin, and is suitable as a multi-epitope vaccine against cryptosporidiosis.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a cryptosporidium multi-epitope gene fragment cpmcef and its fusion protein and application. Background technique [0002] Cryptosporidiosis is a zoonotic infectious disease caused by Cryptosporidium spp. It often causes self-limited diarrhea in healthy people and animals; and in immunocompromised patients, such as In AIDS (AIDS) patients and organ transplant patients, it can lead to serious diseases, even life-threatening. According to the survey, Cryptosporidium is the second most important cause of diarrhea in children under the age of five in the world after rotavirus, and 10.5% of child deaths worldwide are caused by diarrhea. At present, there is no specific drug for the treatment of the disease, and most antibiotics and antiparasitic drugs are ineffective; there is also a lack of preventive vaccines that have obtained clinical approval, and the immune protection ef...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62A61K39/002A61P33/02
CPCC07K14/44A61K39/002A61P33/02C07K2319/40A61K2039/53Y02A50/30
Inventor 陈兆国游艳敏李艳米荣升黄燕韩先干
Owner SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI