Application of arachidonate lipoxygenase (ALOX)12 inhibitor to preparation of heart ischemia reperfusion injury (IRI) therapeutic drug
A technology for reperfusion injury and cardiac ischemia, applied in the field of biomedicine, can solve the problems of injury and high mortality in patients with acute myocardial infarction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0183] Example 1 Changes in the expression of different ALOX in ischemic liver tissue
[0184] C57 mice were randomly divided into two groups, namely the Sham group and the operation group. The liver tissues of the mice in the operation group and the mice in the Sham group were collected after ischemia for 1 hour, and the ALOX12, ALOX5, and ALOX15 proteins in the liver tissues were detected by Western blot and RT-RCR content and mRNA content. The primary antibodies used for WB are: 12-LO Antibody (C-5) (sc-365194; Santa Cruz), 15-LO Antibody (B-7) (sc-133085; Santa Cruz), 5-Lipoxygenase (C49G1) Rabbit mAb (#3289; CST), the secondary antibodies are: Peroxidase AffiniPure goat anti-rabbit-IgG(H+L)(#111-035-003; Jackson Laboratory) and goat anti-mouse-IgG(H+L)(#115 -035-003; JacksonLaboratory); The primer sequences used by RT-RCR are as follows:
[0185] Gene forward primer reverse primer ALOX12 TCCCTCAACCTAGTGCGTTTG GTTGCAGCTCCAGTTTCGC ALOX5 AACGA...
Embodiment 2
[0188] Example 2 Effect of ALOX12 Overexpression on H / R Treatment-Induced L02 Cell Injury and Inflammatory Response
[0189] L02 cells were divided into 4 groups: GFP overexpression control group, ALOX12 overexpression control group, GFP overexpression H / R group, ALOX12 overexpression H / R group. Corresponding plasmids were transfected into adherent L02 cells (about 80% confluency), and H / R treatment was performed after 24 hours (hypoxia for 6 hours and reoxygenation for 6 hours). After the plasmid transfection was completed, the total protein of the cells was extracted and analyzed by WB (three independent repeated experiments, each with 2 repetitions) to detect the overexpression of ALOX12. After the completion of H / R treatment, the release of LDH in the medium was detected (6 replicates per group) to evaluate the effect of ALOX12 overexpression on H / R-induced hepatocyte injury; RNA was extracted for RT-PCR analysis (2 times The experiments were repeated independently, each ...
Embodiment 3
[0195] Example 3 Effect of ALOX12 Knockdown (shALOX12) on H9C2 Cell Activity After H / R Treatment
[0196] H9C2 cells were divided into 4 groups: shRNA control group, shALOX12 control group, shRNA H / R group, and shALOX12 H / R group. The corresponding recombinant lentivirus liquids were used to infect the cultured H9C2 cells, and H / R treatment was performed after 24 hours (hypoxia for 1 hour and reoxygenation for 6 hours). After the plasmid transfection was completed, the total protein of the cells was extracted and analyzed by WB (three independent repeated experiments) to detect the knockdown of ALOX12. Cell viability was detected after H / R was completed (6 replicates per group). Taking the detection result of the shRNA control group as 1, calculate the ratio of the other groups compared to this group.
[0197] ALOX12 knockdown WB detection results are as follows Figure 5 As shown, compared with the shRNA group, the shALOX12 histone band was significantly weakened, that is,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



