A method for increasing rice sterol content by using ginseng transcription factor
A technology of transcription factor and transgenic rice, applied in the field of plant genetic engineering, can solve the problems that have not yet been discovered, and achieve the effects of improving nutritional and health care value and increasing sterol content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Cloning of Ginseng PgERF1 Gene
[0029] (1) Extraction and detection of ginseng total RNA
[0030] The 3-year-old Korean Korean ginseng roots were taken, quickly frozen in liquid nitrogen, and quickly ground with a mortar, and then total RNA was extracted according to the instructions of the EASYspin Plus Plant RNA Rapid Extraction Kit provided by Beijing Aidelai Biotechnology Co., Ltd. The RNA concentration and purity were detected with a NanoDropTM 2000 spectrophotometer from Thermo Fisher. RNA integrity was determined by 1.0% agarose gel electrophoresis.
[0031] (2) Cloning of ginseng PgERF1 gene
[0032] The total RNA of Korean Korean ginseng was reverse transcribed into the first-strand cDNA with PrimeScript™ RT reagent kit from TaKaRa Company. Specific primers were designed according to the cDNA sequence of the AP2 / ERF transcription factor gene reported in the GenBank database to amplify the target gene PgERF1. The primer sequences used are as follows:
[00...
Embodiment 2
[0037] Construction of Plant Expression Vector Containing PgERF1 Gene
[0038]Primers containing KpnI and SacI restriction sites were respectively designed at the 5' end and 3' end of the PgERF1 gene, and PCR amplification was performed according to the conditions of Example 1 using pMD18-T-PgERF1 as a template. The primer sequences are as follows (restriction sites are underlined):
[0039] PgERF1-HF: 5'- GGTACC ATGTGTGGAGGTGCAATCCTAGGTG -3'; PgERF1-HR:5'- GAGCTC TTAAACGACATCGTCGAAACTCC-3'.
[0040] After the PCR product was verified by sequencing, it was double-digested with SacI and KpnI, recovered and purified, and ligated with the pTCK303 vector that was also double-digested with SacI and KpnI to obtain the plant overexpression vector pTCK-PgEFR1 containing the PgERF1 gene (see figure 2 ).
Embodiment 3
[0042] Agrobacterium-mediated transformation of rice with PgERF1 gene to obtain transgenic plants
[0043] Using the freeze-thaw method, the plant overexpression vector pTCK-PgEFR1 was introduced into Agrobacterium tumefaciens EHA105, and single clone colonies were picked for verification. The results showed that the plant overexpression vector containing PgERF1 gene had been successfully constructed into the strain of Agrobacterium tumefaciens.
[0044] Pick a single colony of Agrobacterium and transfer it to YEB solid medium (containing 50 mg.L each of kanamycin and rifampicin) -1 ) were cultured in the dark at 28°C for two days, and the bacterial solution was eluted with an appropriate amount of AAM medium supplemented with 100 μM acetosyringone, suspended in 20 ml AAM medium supplemented with 100 μM acetosyringone, and the concentration of the bacterial solution was adjusted to 1.5-2.0 OD (600nm), the obtained bacterial solution was used for rice callus infection.
[004...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More