Triticum aestivum L. flag leaf length quantitative trait locus (QTL) linked molecular marker and application thereof
What is AI technical title?
AI technical title is built by Patsnap AI team. It summarizes the technical point description of the patent document.
A molecular marker, wheat technology, applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of not many molecular markers
Active Publication Date: 2019-11-26
SICHUAN AGRI UNIV
View PDF6 Cites 10 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0007] Previously, some scholars conducted QTL mapping for flag leaf length, and found that the related QTL existed widely in wheat. However, there are not many closely linked molecular markers related to flag leaf length traits in wheat that can be used in actual molecular breeding.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0042] Example 1 Acquisition of wheat flag leaf length QTL QFll-5B and its molecular marker KASP-5B-FLL
[0043] (1) Using the wheat line '20828' as the female parent and the wheat variety 'Chuannong 16' as the male parent, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 8 Generations, recombinant inbred lines containing 199 lines were obtained to form a genetic mapping population.
[0044] (2) Identification of the flag leaf length phenotype of the recombinant inbred line population: analyze and identify the flag leaf length of the recombinant inbred line during the wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and calculate the flag leaf length. Leaf length, and get the average value, which represents the flag leaf length of the strain.
[0046] a) DNA extraction: The DNA of the parent '20828', 'Chuannong 16...
Embodiment 2
[0055] Example 2 Application of Molecular Marker KASP-5B-FLL in Selection and Control of Flag Leaf Length QTL QFll-5B
[0056] (1) The common wheat line '20828' with long flag leaves was used as the female parent, and the common wheat line 'Chuanmai 60' with short flag leaves was used as the male parent to construct a recombinant inbred line, and 54 lines were randomly selected from the offspring lines .
[0057] (2) Carry out KASP-5B-FLL marker detection on the obtained 54 strains, the specific method is: extract the DNA of 54 strains; use it as a template, and use the specific primer pair of molecular marker KASP-5B-FLL Perform PCR amplification and perform fluorescence readings for primers, which are:
[0058] Primers on the FAM tag: (the underlined part is the FAM tag sequence)
[0059] 5'- GAAGGTGACCAAGTTCATGCT TTGATAGCAAAGTATGTTGC-3' (SEQ ID No. 1)
[0060] Primers on the HEX tag: (the wavy part is the HEX tag sequence)
[0061]
[0062] Universal downstream pri...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to the field of triticum aestivum L. molecular breeding, and particularly discloses a triticum aestivum L. flag leaf length quantitative trait locus (QTL) linked molecular markerand application thereof. The single nucleotide polymorphism (SNP) molecular marker linked with triticum aestivum L. flag leaf length QTL QFll-5B is provided and located on a 5B chromosomelong arm ofa RefSeqv1.0 genome edition, and is the 51st of a sequence shown in SEQ ID NO.31, polymorphism is C / T, and the SNP molecular marker can be obtained by amplification of a primer shown in a nucleotidesequence such as SEQ ID NO.1-3. The SNP molecular marker can accurately trace the triticum aestivum L. flag leaf length QTL QFll-5B, and predict the flag leaf length characteristics of triticum aestivum L., and molecular design breeding is convenient. The invention further discloses a method for identifying the molecular marker. The prediction accuracy of the flag leaf length can be enhanced by using the method, so that varieties or strains of the triticum aestivum L. with increased the flag leaf length are conveniently and rapidly screened for breeding, and the breeding progress of the varieties of the triticum aestivum L. with a high yield can be greatly accelerated.
Description
technical field [0001] The invention relates to the fields of molecular biology and crop genetic breeding, in particular to a SNP molecular marker linked to wheat flag leaf length QTL QFll-5B and the application of the molecular marker. Background technique [0002] Common wheat (Triticum aestivum L.) is one of the most important crops in the world, and its sown area accounts for 20%-30% of the country's arable land. It is the staple food of 35% of the population. According to reports, wheat production should increase by 70% to meet future food demand. [0003] At present, the area of arable land in the world is decreasing and the population is increasing. It is urgently expected that the annual wheat output will increase rapidly. The size of the yield directly depends on the photosynthesis of wheat, and the size of the flag leaf has a great influence on the photosynthesis, so the size of the flag leaf has a great influence on the final yield of wheat. Flag leaf length ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.