Triticum aestivum L. flag leaf length quantitative trait locus (QTL) linked molecular marker and application thereof
A molecular marker, wheat technology, applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of not many molecular markers
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Acquisition of wheat flag leaf length QTL QFll-5B and its molecular marker KASP-5B-FLL
[0043] (1) Using the wheat line '20828' as the female parent and the wheat variety 'Chuannong 16' as the male parent, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 8 Generations, recombinant inbred lines containing 199 lines were obtained to form a genetic mapping population.
[0044] (2) Identification of the flag leaf length phenotype of the recombinant inbred line population: analyze and identify the flag leaf length of the recombinant inbred line during the wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and calculate the flag leaf length. Leaf length, and get the average value, which represents the flag leaf length of the strain.
[0045] (3) 55K SNP chip analysis
[0046] a) DNA extraction: The DNA of the parent '20828', 'Chuannong 16...
Embodiment 2
[0055] Example 2 Application of Molecular Marker KASP-5B-FLL in Selection and Control of Flag Leaf Length QTL QFll-5B
[0056] (1) The common wheat line '20828' with long flag leaves was used as the female parent, and the common wheat line 'Chuanmai 60' with short flag leaves was used as the male parent to construct a recombinant inbred line, and 54 lines were randomly selected from the offspring lines .
[0057] (2) Carry out KASP-5B-FLL marker detection on the obtained 54 strains, the specific method is: extract the DNA of 54 strains; use it as a template, and use the specific primer pair of molecular marker KASP-5B-FLL Perform PCR amplification and perform fluorescence readings for primers, which are:
[0058] Primers on the FAM tag: (the underlined part is the FAM tag sequence)
[0059] 5'- GAAGGTGACCAAGTTCATGCT TTGATAGCAAAGTATGTTGC-3' (SEQ ID No. 1)
[0060] Primers on the HEX tag: (the wavy part is the HEX tag sequence)
[0061]
[0062] Universal downstream pri...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com