Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of Cas13a in antagonistic virus

A virus and antagonistic technology, applied in the direction of antiviral agents, medical preparations containing active ingredients, biochemical equipment and methods, etc., can solve the problems that human viruses have not been tried, and achieve a wide range of applications and high RNA cutting activity Effect

Pending Publication Date: 2019-12-10
INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, Cas13a is mainly used to cut the RNA components in plant viruses, thereby inhibiting plant viruses, but no attempt has been made against human viruses, so it is necessary to study the inhibition of human viruses by Cas13a, and develop a method that uses Cas13a to antagonize human viruses. means

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Cas13a in antagonistic virus
  • Application of Cas13a in antagonistic virus
  • Application of Cas13a in antagonistic virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Cas13a inhibits HIV

[0040] In this experiment, we want to use Cas13a to target HIV-1 RNA to inhibit HIV-1 replication. First, design and synthesis of crRNA targeting various regions of HIV-1, and experimental results found that in the presence of specific crRNA, Cas13a significantly reduced the expression of the HIV reporter gene YFP. Subsequently, the HIV-1 RNA content will be further tested to verify that Cas13a cleavage leads to the degradation of HIV RNA, which in turn affects the level of DNA that is finally integrated into the host cell genome.

[0041] 1.1 Cas13a / crRNA interferes with HIV-1 replication

[0042] We designed crRNA targeting various regions of HIV-1 (see Table 1 for the targeting sequence of crRNA) to construct LbuCas13a / crRNA. Transfection of Lbu Cas13a / crRNA into 293T cells, 24 hours after transfection, infection with HIV-1 packaged by VSV-G NL4-3-△E-YFP virus. After 24 hours of infection, the cells were collected, and the expression rati...

Embodiment 2

[0048] Example 2 Cas13a inhibits IAV (influenza A virus)

[0049] We designed NP targeting IAV (WSN, H3N2) and crRNA of PB2 (see Table 2 for the targeting sequence of crRNA) to construct Lbu Cas13a / crRNA and LwaCas13a / crRNA. Lbu Cas13a / crRNA and LwaCas13a / crRNA were transfected into 293T cells, 24 hours after transfection, IAV (WSN, H3N2) virus was infected. After 24 hours of infection, cells were collected and real-time quantitative PCR was used to detect the levels of NP mRNA and vRNA of IAV. The result is Figure 6-Figure 15 As shown, in the presence of specific crRNA, Lbu Cas13a and LwaCas13a / crRNA significantly reduce the levels of NP mRNA and vRNA of IAV.

[0050] Table 2 IAV crRNA targeting sequence

[0051] name Targeting sequence NP crRNA1 ATCGTTTGGTGCCTTTGGTCGCCATGAT NP crRNA4 ATCATGGCGACCAAAGGCACCAAACGAT PB2 crRNA1 ATCTGCTGATACTGTGGCTCTTCTTACT PB2 crRNA4 AGTAAGAAGAGCCACAGTATCAGCAGAT

Embodiment 3

[0052] Example 3 Cas13a inhibits EV71

[0053] EV71 is a single-stranded positive-stranded RNA virus, and its structural genes 2A, 3D, and 3C are relatively conservative in sequence. We designed crRNA targeting 2A, 3D and 3C of EV71 (see Table 3 for the targeting sequence of crRNA) to construct Lwa Cas13a / crRNA. The Lwa Cas13a / crRNA was transfected into 293T cells, 24 hours after transfection, EV71 virus was infected, and the cells were collected for Western blotting to detect EV71 protein expression ( Figure 16 ), qPCR experiment to detect the mRNA level of EV71 ( Figure 17 ), collect the supernatant to detect the virus titer ( Figure 18 ). The result is Figure 16-18 As shown, in the presence of specific crRNA, Lwa Cas13a significantly reduced EV71 protein, mRNA levels, and released virus titer.

[0054] Table 3 EV71 crRNA targeting sequence

[0055] name Targeting sequence cr2A CAATCGCAACGGGCAATCGTGTCACAAC cr3D GCATCATAACCTGAGTAGTCAAAGGCAA cr3C ACATGGTGAAATGCCCCTGGTCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of Cas13a in an antagonistic virus. Cas13a comes from any one of Leptotrichia buccalis, listeria seeligeri, Leptotrichia shahii and Leptotrichia wadei CRISPR (clustered regularly interspaced short palindromic repeats) systems, and the virus is one or more of a DNA virus, a RNS virus and a retrovirus of human being. Three different types of viruses (includingthe DNA virus, the RNA virus and the retrovirus) are inhibited in a life cycle in cells through a gene editing technology, and a result displays higher RNA nicking activity and wider application range.

Description

Technical field [0001] The present invention relates to the field of biotechnology, in particular to the application of Cas13a in antagonizing viruses. Background technique [0002] The CRISPR / Cas system is an immune system currently found in most bacteria and all archaea. It is used to identify and destroy the defense system against the invasion of phages and other pathogens. In the CRISPR / Cas system, CRISPR is the abbreviation for clustered regularly interspaced shortpalindromic repeats, which refers to a unique DNA region in the bacterial genome and also stores viral DNA fragments to allow cells to recognize any attempt Where it reinfects the virus, the RNA sequence (called crRNA) produced by CRISPR transcribing recognizes the genetic material of the invasive virus. Cas is the abbreviation of CRISPR-associated protein (CRISPR-associated proteins, Cas). The Cas protein cuts the target DNA on the bacterial genome like a pair of molecular scissors. [0003] The CRISPR / Cas system ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/46A61P31/12A61P31/14A61P31/20A61P31/18A61P31/16C12N9/22C12N15/113
CPCA61K38/465A61P31/12A61P31/14A61P31/16A61P31/18A61P31/20C12N9/22C12N15/1131C12N15/1132C12N2310/20
Inventor 郭斐胡斯奇许丰雯梅珊殷利眷赵斐黄羽
Owner INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com