Ubiquitin ligase smurf1 mutant, encoding gene and use

A technology of ubiquitin ligase and mutants, which is applied in the fields of molecular biology and medicine, can solve problems such as unclear molecular mechanisms, and achieve the effect of inhibiting the occurrence of cancer

Active Publication Date: 2021-04-13
BEIJING INSTITUTE OF TECHNOLOGYGY
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its molecular mechanism remains unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ubiquitin ligase smurf1 mutant, encoding gene and use
  • Ubiquitin ligase smurf1 mutant, encoding gene and use
  • Ubiquitin ligase smurf1 mutant, encoding gene and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: expression vector construction

[0027] 1. Experimental method

[0028] Myc-Smurf1 plasmid, pET-21a plasmid, HA-Ub plasmid, lentiviral expression vector PCDH-3HA, lentiviral packaging plasmid PSPAX2 and envelope plasmid PMD2G were purchased from Addgene.

[0029] (1) Site-directed mutation (taking the 69th amino acid mutation "Y69F" from Y to F as an example, the construction process of other types of mutations is similar)

[0030] The Myc-Smurf1 plasmid (other plasmids inserted with Smurf1 can also be used) was subjected to site-directed mutagenesis. The amino acid sequence of Smurf1 is shown in SEQ ID No.1, and its nucleotide sequence is shown in SEQ ID No.4.

[0031] The specific operation is as follows:

[0032] The primers for site-directed mutagenesis are listed in the table below:

[0033] Primer name Primer sequence (5'-3') SEQ ID XQ5 CACTATGATCTATTTGTTGGGAAAACG SEQ ID No: 5 XQ6 CTGGTTCCACTTTGGGTCCAA SEQ ID No: 6...

Embodiment 2

[0052] Example 2: Protein expression and functional identification

[0053] 1. Experimental method

[0054] (1) Recombinant lentiviral packaging

[0055] The empty vector, wild-type and mutant recombinant lentiviral expression vectors were transfected into 293T cells by vigo using PSPAX2 and PMD2G plasmids respectively, the medium was changed 4 hours after transfection, and the virus liquid was collected 72 hours after the medium change (supernatant of transfected 293T cells solution), centrifuged at 3000rpm for 5min, filtered through a 0.45μm membrane filter, and stored at -80℃ after aliquoting.

[0056] 293T cells were cultured in DMEM (Dulbecco's modified Eagle medium) (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (fetal bovine serum, FBS) (Gibco, Grand Island, NY, USA), and the culture medium contained 100 IU / ml penicillin and 100 μg / ml streptomycin (Gibco). Cells were placed at 37°C 5% CO 2 cultured in an incubator.

[0057] (2) Lentivirus infecti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedicine and relates to the discovery and verification of the site function of a carcinogenic-related protein Smurf1 protein. Mutation of this site leads to complete loss of its protein function. The significance is that the mutation of the 69 position of Smurf1 protein will reduce the function of Smurf1 as E3 ligase activity, thereby inhibiting tumorigenesis. The invention further expands and perfects tumor research, and provides a target site for the treatment of tumors and the development of target drugs.

Description

technical field [0001] The invention relates to the fields of molecular biology and medicine, in particular to a recognition of the function of the Smurf1 protein site affecting tumor formation and its application in tumor treatment. Background technique [0002] Since the 1980s, the incidence and mortality of malignant tumors have been increasing year by year, and have gradually become the number one killer of human life. And as the world's population ages, the number of deaths from malignant tumors will continue to rise. At present, the total number of malignant tumor deaths in my country accounts for nearly a quarter of the world. The harm of malignant tumors to human health has attracted the attention of our country, and the treatment of this disease is also an important topic of concern to medical researchers and public health departments. [0003] Smad ubiquitination regulator 1 (Smurf1) is an E3 ligase that can selectively bind to members of the Smad family of recep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/85A61K38/53A61P35/00
CPCA61K38/53A61P35/00C12N9/93C12N15/85C12Y603/02019
Inventor董磊夏琴
OwnerBEIJING INSTITUTE OF TECHNOLOGYGY