Application of long non coding RNA and interfering RNA thereof to treatment on atherosclerosis

An atherosclerosis, long-chain non-coding technology, applied in the field of biomedicine, can solve problems such as unclear function of lncRNA, and achieve the effect of avoiding the occurrence of clinical time, delaying or even reversing the disease

Active Publication Date: 2020-02-14
HARBIN MEDICAL UNIVERSITY
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, research on lncRNAs has progressed rapidly, but the functions of most lncRNAs are still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of long non coding RNA and interfering RNA thereof to treatment on atherosclerosis
  • Application of long non coding RNA and interfering RNA thereof to treatment on atherosclerosis
  • Application of long non coding RNA and interfering RNA thereof to treatment on atherosclerosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Pathological staining after establishment of atherosclerosis mouse model at different stages

[0027] 1. Materials

[0028] 1.1 Animals

[0029] The Apoe mice of the present invention are purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd., and the experimental animals are divided into groups at random, and are respectively fed at the age of 12 weeks (starting high-fat feeding for 4 weeks at the age of 8 weeks, EAR group) and at the age of 24 weeks (8 weeks). At the age of 16 weeks, high-fat feeding was started for 16 weeks, and the aorta was obtained from the ADV group). The use of experimental animals was approved by the Ethics Committee of Harbin Medical University.

[0030] 1.2 Reagents

[0031] High-fat feed (10% lard, 4% milk powder, 2% cholesterol, 0.5% sodium cholate) was purchased from Nanjing Senbao Biological Products Co., Ltd., and the improved oil red O staining solution was purchased from Beijing Suolaibao Co., Ltd. ...

Embodiment 2

[0041]Example 2: Expression of LncRNA-AFIAR in arterial tissue of mice with atherosclerosis at different stages

[0042] 1. Materials

[0043] 1.1 Organization

[0044] Apoe of the present invention - / - The mice were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. The experimental animals were randomly divided into groups, and the main materials were collected at the age of 8 weeks (NOR group) and 24 weeks of age (high-fat feeding for 16 weeks at the age of 8 weeks, ADV group). artery. The use of experimental animals was approved by the Ethics Committee of Harbin Medical University.

[0045] 1.2 Reagents

[0046] TRIzol Reagent was purchased from Invitrogen, USA. The reverse transcription kit (04897030001) was purchased from Roche, Germany. The SYBRGreen Master (ROX) kit used for real-time quantitative PCR (polymerase chain reaction) was purchased from Roche, Germany. Real-Time PCR specific primers were designed and synthesized by Ruibo Xin...

Embodiment 3

[0063] Example 3: Construction of the silencing model of lncRNA-AFIAR in RAW264.7 cells

[0064] 1. Materials

[0065] 1.1 Cells and siRNA

[0066] The RAW264.7 cells used in the present invention are purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, and the cell culture application contains 10% inactivated fetal bovine serum (Science Cell, USA), penicillin (100 U / mL), streptomycin (100 μg / mL) In DMEM medium, the culture conditions were 37°C, 5% CO2.

[0067] Design related silencing lncRNA-AFIAR (siRNA) sequence, sense strand (Sence): GCAGAUAACUCGUUAGCAAUU (shown in SEQ ID NO.4), antisense strand (Antisense): UUGCUAACGAGUUAUCUGCUU (shown in SEQ ID NO.5). The design and synthesis of small interfering RNA (siRNA) were completed by Suzhou Gemma Gene Co., Ltd.

[0068] 1.2 Reagents

[0069] X-tremeGENE siRNA Transfection Reagent used for small interfering RNA (siRNA) transfection was purchased from Roche Company in Germany; DMEM medium was purchased fr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of long non coding RNA (lncRNA) and interfering RNA thereof to treatment on atherosclerosis. Through high-throughput sequencing on an aortic tissue of an atherosclerosis mouse model, the invention discovers that the expression of lncRNA molecules in normal and late atherosclerosis mice is obviously different; and meanwhile, the lncRNA molecules are highly expressed in the atherosclerosis tissue and the lncRNA molecules are named as lncRNA-AFIAR. The experiment proves that the lncRNA-AFIAR has the functions of enhancing proliferation of macrophages, inhibiting macrophage apoptosis and the like and participates in the process of promoting the progress of the atherosclerosis. The aims of inhibiting the proliferation of the macrophages and reducing plaque formation can be fulfilled by inhibiting the lncRNA-AFIAR, so that the aim of inhibiting the progress of the AS. Therefore, the invention provides new molecular markers and intervention targets for diagnosing and treating the atherosclerosis and also provides new technical means for treating the atherosclerosis.

Description

technical field [0001] The invention relates to the application of a long-chain non-coding RNA and its interference RNA in the treatment of atherosclerosis. The invention belongs to the technical field of biomedicine. Background technique [0002] In January 2018, the National Center for Cardiovascular Diseases released the "China Cardiovascular Disease Report 2017". He pointed out that in 2017, the number of patients with coronary atherosclerotic heart disease in my country reached 11 million. Overall, the prevalence and mortality of cardiovascular diseases in China are still on the rise, and the number of patients with cardiovascular diseases will remain unchanged in the next 10 years. will grow rapidly. As a high incidence of cardiovascular disease, coronary heart disease is one of the diseases with the highest mortality rate in the world. According to the report of the World Health Organization in 2011, the death toll of coronary heart disease in China ranks second in t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12Q1/6883A61K45/00A61P9/10
CPCA61K45/00A61P9/10C12N15/113C12N2310/10C12N2310/14C12Q1/6883C12Q2600/158C12Q2600/178
Inventor于波田进伟孙长斌袭祥文顾霞刘新新
OwnerHARBIN MEDICAL UNIVERSITY