Dual-plasmid food-grade lactobacillus plantarum expression system and application thereof
A technology of Lactobacillus plantarum and expression system, applied in the field of double-plasmid food-grade Lactobacillus plantarum expression system, can solve the problems of limited capacity and increased difficulty of plasmid expression system
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0116] The construction of food-grade host Lactobacillus plantarum NZ0203 comprises the following steps:
[0117] (1) Inoculate Lactobacillus plantarum WCFS1 in MRS liquid medium, collect the bacteria after static culture at 37°C overnight, and use bacterial genome extraction kit to extract genomic DNA; MRS medium contains: 10.0g peptone per liter, beef extract Yeast powder 5.0g, yeast extract powder 4.0g, glucose 20.0g, dipotassium hydrogen phosphate 2.0g, triammonium citrate 2.0g, sodium acetate 5.0g, magnesium sulfate 0.2g, manganese sulfate 0.05g, Tween 80 1.0mL, Measure water.
[0118] (2) With the genomic DNA of step (1) as a template, utilize the nucleotide sequence as primers of SEQ ID NO.1 and SEQ ID NO.2 to carry out PCR amplification gene lacA to LacA-up-F and LacA-up-R The upstream homology arm of
[0119] LacA-up-F: ggtaccgggccccccctcgagTCCGTGGAATAAACCGGTTCA SEQ ID NO.1
[0120] LacA-up-R:TTAAGTGGGGTGAAATTAATGGCAC SEQ ID NO.2
[0121] The PCR amplification sys...
Embodiment 2
[0159] Food-grade expression vectors pLP4180 and pLP5120
[0160] The food-grade expression vector pLP4180 contains the following elements: the replication element from plasmid pNZ8149, the P ldhL promoter and T ldhL terminator, and the lacM gene derived from Lactobacillus plantarum WCFS1. Its spectrum is as image 3 As shown, the sequence was synthesized by Shanghai Sangon Bioengineering Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.13. The food-grade expression vector pLP5120 contains the following elements: origin of replication from plasmid pNZ8149, P ldhL promoter and T ldhL terminator, and the lacL gene derived from Lactobacillus plantarum WCFS1. Its spectrum is as Figure 4 As shown, the sequence was synthesized by Shanghai Sangon Bioengineering Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.14. After the synthetic expression vectors pLP4180 and pLP5120 were co-transformed into Lactobacillus plantarum NZ0203, its growth in the MRS-lac...
Embodiment 3
[0162] Application of the above-mentioned dual-plasmid food-grade Lactobacillus plantarum expression system for expressing nisin in the process of preparing yogurt
[0163] Utilize the primer pair nis1-F and nis1-R of SEQ ID NO.15 and SEQ ID NO.16 to amplify the nisin synthesis cluster gene nisABTCI, the amplified product is digested with XhoI, and the vector pLP4180 Digested with XhoI, the digested product was digested with T 4 DNA polymerase just connects; Utilize the primer pair nis2-F and nis2-R of SEQ ID NO.17 and SEQ ID NO.18 to amplify the nisin synthesis cluster gene nisPRKFEG, and the amplified product uses XhoI enzyme Cut, and digest the vector pLP5120 with XhoI, and use T 4DNA polymerase performs the ligation. The ligation product was co-transformed into Lactobacillus plantarum NZ0203, and the transformants were screened on MRS-lactose medium. The screened transformants were extracted with plasmids for verification. The correct transformants were transferred to m...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


