Food-grade lactobacillus plantarum expression system and application thereof to yogurt preparation
A technology of Lactobacillus plantarum and expression system, applied in the field of food-grade Lactobacillus plantarum expression system and its application in yoghurt preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0117] The construction of food-grade host Lactobacillus plantarum NZ1210 comprises the following steps:
[0118] (1) Inoculate Lactobacillus plantarum WCFS1 in MRS liquid medium, collect the bacteria after static culture at 37°C overnight, and use bacterial genome extraction kit to extract genomic DNA; MRS medium contains: 10.0g peptone per liter, beef extract Yeast powder 5.0g, yeast extract powder 4.0g, glucose 20.0g, dipotassium hydrogen phosphate 2.0g, triammonium citrate 2.0g, sodium acetate 5.0g, magnesium sulfate 0.2g, manganese sulfate 0.05g, Tween 80 1.0mL, Measure water.
[0119] (2) With the genomic DNA of step (1) as a template, utilize the nucleotide sequence as primers of SEQ ID NO.1 and SEQ ID NO.2 to carry out PCR amplification gene lacA to LacA-up-F and LacA-up-R The upstream homology arm of
[0120] LacA-up-F: ggtaccgggccccccctcgagTCCGTGGAATAAACCGGTTCA SEQ ID NO.1
[0121] LacA-up-R:TTAAGTGGGGTGAAATTAATGGCAC SEQ ID NO.2
[0122] The PCR amplification sys...
Embodiment 2
[0160] Food grade expression vector pLP4180
[0161] The food-grade expression vector pLP4180 contains the following elements: the replication element from plasmid pNZ8149, the P ldhL promoter and T ldhL terminator, and the lacM gene derived from Lactobacillus plantarum WCFS1. Its spectrum is as image 3 As shown, the sequence was synthesized by Shanghai Sangon Bioengineering Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.13. After the synthetic expression vector pLP4180 was transformed into Lactobacillus plantarum NZ1210, its growth in MRS-lactose medium was not only restored, but also close to the level of wild-type WCFS1 ( Image 6 and Figure 7 ).
Embodiment 3
[0163] Express green fluorescent protein using the above food-grade expression system
[0164] Utilize the primers whose nucleotide sequences are SEQ ID NO.16 and SEQ ID NO.17 to carry out PCR amplification on gfp-F and gfp-R, use NdeI and BamHI to double digest the amplified product, and use NdeI and BamHI to vector pLP4180 BamHI double enzyme digestion, the digested product uses T 4 The DNA polymerase is connected, and the connected product is transformed into Lactobacillus plantarum NZ1210. The transformants are screened on the MRS-lactose medium, and the screened transformants are extracted from the plasmid for verification. The verified correct transformants are transferred to fresh liquid MRS-lactose culture. After culturing at 37°C for 24 hours, the expression of green fluorescent protein in NZ1210 was detected with a fluorescent microplate reader, and the results were as follows: Figure 4 shown.
[0165] gfp-F:ATACATATGAGCAAAGGAGAAGAAC SEQ ID NO.16
[0166] gfp-R:A...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


