A primer set, kit and detection method for rapid detection of human dys385 gene

A detection kit and primer set technology, which is applied in the field of forensic detection, can solve problems such as the limited number of detection personnel, the impossibility of on-site rapid detection of detection materials, and the difficulty of detection, so as to save material costs and time costs, and the results are intuitive and visualized , The effect of low detection environment requirements

Active Publication Date: 2022-06-28
THE FIRST RES INST OF MIN OF PUBLIC SECURITY +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, the amplification process after the DNA extraction of the samples takes at least 2 to 4 hours, and the detection of the amplification products usually takes about 1 hour.
In addition, it is necessary to optimize the renaturation temperature to improve the specificity during the operation, the work is cumbersome and complicated, and the reaction takes a long time
And because the amplification procedure requires a professional laboratory environment and precision instruments, it is difficult to carry out detection on site, and all of them need to be sent for inspection. The inspection process will also cause time consumption and increase the detection cost.
In the process of submitting for inspection, it is also easy to cause damage and loss of samples submitted for inspection, resulting in the loss of important evidence
In case of corrupt samples, special packaging is required. If not handled properly, it is easy to contaminate the inspectors during the inspection process.
[0005] (2) Strong professionalism: the entire detection process needs to be carried out in a professional laboratory environment, and the analysis of the experimental operation and amplification results needs to be judged by professionally trained professionals
Due to the high requirements for testing, the limited number of testing institutions and professional testing personnel, and the large number of samples submitted for testing, it is difficult to quickly obtain test results, and it is often necessary to wait in line for testing
[0006] (3) On-site rapid detection cannot be realized: Each cycle of traditional PCR includes three steps of denaturation, annealing and extension. Therefore, an instrument with precise temperature regulation must be used. It is difficult to apply outdoor or on-site detection, and must rely on professional Laboratories and professional experimenters, so on-site rapid detection of inspection materials cannot be realized
[0007] (4) For corrupt samples or old samples, the detection is relatively difficult. In order to obtain accurate results, multiple detections are required

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer set, kit and detection method for rapid detection of human dys385 gene
  • A primer set, kit and detection method for rapid detection of human dys385 gene
  • A primer set, kit and detection method for rapid detection of human dys385 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Primer Design

[0049] DNA template (SEQ ID No. 9):

[0050] AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGAAATGAAATTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAAAAGAGAAAAAGAGAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGAAAAAGAAAGGAGGACTATGTAATTGGAATAGATAGATTATTTTTTAAAATATTTTTATTACCTTTACAGTTTTTTTAAATGCCGCCATTTCAGAAAGAAATCTGGTCACAGCCCTTACCAGCTTTACCTAGCATCCCA

[0051] Primer design: Primers were designed by LAMP online design software https: / / primerexplorer.jp.

[0052] Primer synthesis company: Zhongmeitaihe Biotechnology (Beijing) Co., Ltd.

[0053] The primers screened by the design of the present invention are as follows:

[0054] Table 1

[0055] primer name Primer number Primer sequence Primer F1 SEQ ID No.1 AGCATGGGTGACAGAGCTA Primer B1 SEQ ID No.2 TGGGATGCTAGGTAAAGCTG Primer F2-1 SEQ ID No.3 ACACCATGCCAAACAACAAC Primer B2-1 ...

Embodiment 2

[0056] Embodiment 2 utilizes the test kit of the present invention to detect the accuracy verification

[0057] 1. Sample to be tested: 9948DNA (purchased from promega company)

[0058] 2. Use the kit of the present invention to detect the above-mentioned sample:

[0059] (1) Sample amplification:

[0060] Preparation reaction system: Bst DNA polymerase (8U / ul) 1ul, 10*Bst DNA polymerase buffer 2.5ul, primer F1 (SEQ ID No.1) 10mmol / L 1ul, primer B1 (SEQ ID No.2) 10mmol / L 1ul, primer F2-1 (SEQ ID No.3) 10mmol / L 1ul, primer B2-1 (SEQ ID No.4) 10mmol / L 1ul, primer F2-2 (SEQ ID No.5) 10mmol / L1ul, primer B2 -2 (SEQ ID No.6) 10mmol / L 1ul, primer LOOP-F (SEQ ID No.7) 10mmol / L1ul, primer LOOP-B (SEQ ID No.8) 10mmol / L 1ul, MgSO 4 (100mmol / L) 0.9ul, calcein (625umol / L) 1ul, manganese chloride (7.5mmol / L) 1ul, sample DNA (10ng / ul) 1ul, double distilled water to make up 25ul.

[0061] At the same time, a control group was set up, except that the sample DNA was replaced with double dis...

Embodiment 3

[0064] Example 3 Sample size test of the kit of the present invention

[0065] (1) Sample amplification:

[0066] Sample DNA gradient dilution: use double-distilled water to dilute the concentration of 9948 DNA. The diluted sample concentrations are: 10ng / ul, 5ng / ul, 2ng / ul, 1ng / ul, 0.5ng / ul, 0.2ng / ul, 0.1 ng / ul.

[0067] Preparation reaction system: Bst DNA polymerase (8U / ul) 1ul, 10*Bst DNA polymerase buffer 2.5ul, primer F1 (SEQ ID No.1) 10mmol / L 1ul, primer B1 (SEQ ID No.2) 10mmol / L 1ul, primer F2-1 (SEQ ID No.3) 10mmol / L 1ul, primer B2-1 (SEQ ID No.4) 10mmol / L 1ul, primer F2-2 (SEQ ID No.5) 10mmol / L1ul, primer B2-2 (SEQ ID No.6) 10mmol / L 1ul, primer LOOP-F (SEQ ID No.7) 10mmol / L1ul, primer LOOP-B (SEQ ID No.8) 10mmol / L 1ul, MgSO 4 (100mmol / L) 0.9ul, calcein (625umol / L) 1ul, manganese chloride (7.5mmol / L) 1ul, diluted sample DNA 1ul, double distilled water to make up 25ul. Wherein PCR tubes 1 to 7 correspond to DNA templates of 10ng / ul, 5ng / ul, 2ng / ul, 1ng / ul, 0.5ng / u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer set for rapidly detecting human DYS385 gene. Wherein, the primer set is composed of the following primers: primer F1 as shown in SEQ ID No.1; primer B1 as shown in SEQ ID No.2; primer F2-1 as shown in SEQ ID No.3; primer B2-1 As shown in SEQ ID No.4; Primer F2-2 as shown in SEQ ID No.5; Primer B2-2 as shown in SEQ ID No.6; Primer LOOP-F as shown in SEQ ID No.7; Primer LOOP -B is shown in SEQ ID No.8. The detection time required by the present invention is short, and the corresponding primers and kit can quickly detect the human DYS385 gene within 30 minutes to determine the sex of the human sample.

Description

technical field [0001] The invention relates to a detection kit and a method, in particular to a primer set, a kit and a detection method for rapid detection of human DYS385 gene, belonging to the field of forensic detection. Background technique [0002] Humans have a total of 46 chromosomes, of which 22 are autosomes and the other two are sex chromosomes. Females have XX and males have XY. The DNA level identification of the human Y chromosome can be achieved by amplifying the unique genes of the human Y chromosome. The X chromosome cannot amplify the target fragment, but the Y chromosome can amplify the target fragment. Relying on this principle, the currently commonly used forensic DNA gender identification method is to use an identification kit to amplify the test material in a professional laboratory environment, and to detect the amplified product on a capillary electrophoresis apparatus. By amplifying the DYS38 locus, the female sample has no amplification peak, but...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6879C12Q1/6844C12N15/11
CPCC12Q1/6879C12Q1/6844C12Q2531/119
Inventor荣海博赵怡鹤姜伯玮管桦王峰张黎明张涛金川
OwnerTHE FIRST RES INST OF MIN OF PUBLIC SECURITY