Construction method of novel base conversion editing system and application thereof

A technology of editing system and construction method, which is applied in the field of construction of a new base conversion editing system, and can solve problems such as inability to realize changes, low activity of adenine deaminase, narrow mutation window of cytosine deaminase, etc.

Active Publication Date: 2020-02-25
EAST CHINA NORMAL UNIVERSITY
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, in the existing research results, the gene editing system either performs C / G editing alone to T / A (cytidine deaminase), or alone performs A / T editing to G / C (adenine deaminase). enzyme), if the two systems are directly transferred into the cell at the same time, since the action sites of the two enzymes are similar, and they are fused to cas9 at the same time, then only a certain base can be realized on one allele The editing of two single bases cannot achieve two kinds of single base changes, and there are also defects that the mutation window of cytosine deaminase is too narrow (only 4-8 bases), and the activity of adenine deaminase is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of novel base conversion editing system and application thereof
  • Construction method of novel base conversion editing system and application thereof
  • Construction method of novel base conversion editing system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0158] Embodiment 1, the construction of the second vector or the second nucleic acid construct

[0159] 1. Target sequences derived from human loci EMX1, PD-1, VEGFA

[0160] According to the working principle of CRISPR / Cas9 and BE3, ABE7.10, in NCBI, obtain the targets where C or A simultaneously appear in the ACBE window on human loci (such as EMX1, PD-1, VEGFA), as shown in Table 1 below shown.

[0161] Table 1. Target sequences of human-derived loci EMX1, PD-1, VEGFA

[0162] target name sequence(5`-3`) EMX1-BE3-sg1 SEQ ID NO.8 AAGGACGGCGGCACCGGCGGGGG PD-1-sg1 SEQ ID NO.9 CTGCAGCTTCTCCAACACATCGG PD-1-sg2 SEQ ID NO.10 CAGCAACCAGACGGACAAGCTGG PD-1-sg3 SEQ ID NO.11 GGACCGCAGCCAGCCCGGCCAGG PD-1-sg4 SEQ ID NO.12 CTTCCACATGAGCGTGGTCAGGG VEGFA-sg2 SEQ ID NO.13 GGCGAGCCGCGGGCAGGGGCCGG

[0163] 2. Design sgRNAoligo according to the target sequence

[0164] The construction of the target plasmid (the target pl...

Embodiment 2

[0178] Embodiment 2, the construction of ABE7.10 gene editing vector or nucleic acid construct

[0179] On the basis of ABE7.10 (addgene #102919), AID and Apobec1 were respectively cloned to the C-terminal of ABE7.10 by PCR, and wild TadA was cloned to the N-terminal of ABE7.10 to obtain the following Picture 1-1 and the plasmids or constructs shown in 1-2.

Embodiment 3

[0180] Example 3. Design and construction of different base conversion editing systems ACBE

[0181] 1. in Picture 1-1 and Figure 1-2 Based on the base conversion editing system, other different base conversion editing systems were designed, that is, AID and Apobec1 were respectively cloned into the C-terminal and N-terminal of ABE7. Clone a T after the C-terminus 2 A-UGI, you can get as follows figure 1 Plasmids indicated. The primers used are shown in Table 3 below:

[0182] Table 3 Primer sequences for constructing different base conversion editing systems

[0183]

[0184]

[0185] 2. Construction of U6-sgRNA-CMV-UGI-T 2 A-GFP

[0186] With the primers listed in Table 4 below, CMV, UGI, T 2 A-GFP, assembled onto U6-sgRNA(EcoRV+NotI) plasmid.

[0187] Table 4 Primer sequences for constructing different base conversion editing systems

[0188]

[0189] 3. Detection of working window and working efficiency of ACBE-N-AID and ACBE-N-Apobec1 mutant endogenou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method of a novel base conversion editing system. According to the constructed editing system, the function of a single-base gene editing system is reserved, which is characterized in that conversion from C / G to T / A of a single base at a specified site is realized, the conversion from specific sites A / T to G / C, and the conversion from the specific sites C / G toT / A and A / T to G / C can be also realized. The basic group conversion editing system comprises sgRNA, nuclease for targeted recognition of DNA sequence, cytosine deaminase, adenosine deaminase and an uracil glycosidase inhibitor. The invention also provides a product prepared by the method and related application. According to the invention, the technical limitation that only single-type base conversion can be carried out in the prior art is broken through, DNA base change in a larger range can be realized, and a base editing tool box is further enriched.

Description

technical field [0001] The invention relates to the technical field of editing, in particular to a construction method and application of a novel base conversion editing system. Background technique [0002] Gene editing technology belongs to a new molecular biology tool for DNA sequence fixed-point transformation. It can recognize a specific paired DNA sequence under the guidance of an artificially designed RNA sequence. In addition to realizing the conversion of a single base C / G to T / A within a specific window, it can also realize the conversion of A / T to G / C, and also realize the conversion of C / G to T / A and A / T Simultaneous conversion to G / C, forming two types of base conversion, modifying the sequence of protein coding, gene transcription regulation, and non-coding RNA of this section of DNA, realizing a series of new biological function changes, which can be widely used Applications related to DNA transformation, such as the improvement of biological materials, the i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/90C12N9/22C12N15/55C12N15/63
CPCC12N15/113C12N15/902C12N9/22C12N9/78C12N15/63C12Y305/04002C12Y305/04001C12N2310/10
Inventor李大力谢玲张晓辉朱碧云刘明耀
OwnerEAST CHINA NORMAL UNIVERSITY