Check patentability & draft patents in minutes with Patsnap Eureka AI!

A specific detection target of Phytophthora winteris phibe_s00001g00026.1 and its application

A winter-growing Phytophthora specific technology, applied in the field of gene detection, can solve the problems of long cycle, poor specificity of detection methods, few specific detection targets, etc., and achieve the effect of high accuracy

Active Publication Date: 2020-10-02
NANJING FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problems of long period, poor specificity and low sensitivity of the biological detection method of Phytophthora winteris in the prior art, there are few specific detection targets

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A specific detection target of Phytophthora winteris phibe_s00001g00026.1 and its application
  • A specific detection target of Phytophthora winteris phibe_s00001g00026.1 and its application
  • A specific detection target of Phytophthora winteris phibe_s00001g00026.1 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1791 Phytophthora winteris-specific genes were obtained through whole-genome sequence alignment, and a high-reliability specific molecular detection target Phibe_s00001g00026.1 was excavated from it. Its DNA sequence is shown in SEQ ID NO: 1, and its position in the genome It is scaffold_1:26758-26364 (395bp), its CDS sequence is shown in SEQ ID NO: 2, and its protein sequence is shown in SEQ ID NO: 3, and a sensitive and accurate PCR detection technology system is established based on this new target.

[0028] The PCR detection primer composition used in this detection technology system: by the upstream primer Phi-F and the downstream primer Phi-R, the specific sequences of each primer are as follows:

[0029] Phi-F: ATGACGCCGACACGTTGTAA (SEQ ID NO: 4)

[0030] Phi-R: TCATTGGTCAGCCAATCCGA (SEQ ID NO: 5)

[0031] Extract the DNA of the microorganism to be tested, take 1 μL of the DNA solution, add 23 μL of the detection solution in the kit and 1 μL of sterilized deioni...

Embodiment 2

[0034] In order to verify the specific primer sequence of P. DNA from Phytophthora winteris. The specific method is as follows: Take a small amount of mycelium powder, add 900 μL 2% CTAB extract and 90 μL 10% SDS, vortex and mix well, put in a water bath at 55°C for 1 hour, and invert several times every 10 minutes. Centrifuge at 12000rpm for 10min, take the supernatant and add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1), mix by inverting, centrifuge at 12000rpm for 10min; transfer the supernatant to a new tube, add an equal volume of chloroform, and mix gently by inverting Evenly, centrifuge at 12000rpm for 5min. Transfer the supernatant to a new tube, add 2 times the volume of absolute ethanol and 1 / 10 volume of 3M NaAc (pH5.2), and precipitate at -20°C (>1h). Centrifuge at 12000 rpm for 10 min, pour off the supernatant, wash the precipitate twice with 70% ethanol, and dry at room temperature. Add an appropriate amount of sterilized ultrapure water or T...

Embodiment 3

[0041] For the selection of the specific detection target of Phytophthora winteris and the design of the PCR primer set, the present invention preliminarily selected 6 targets (Phibe_s00001g00026.1, Phibe_s00001g00031.1, Phibe_s00041g00025.1, Phibe_s00041g00026.1, Phibe_s00041g00028.1) and Based on 6 targets, multiple pairs of qualified primers were designed, and finally a new target for specific detection, Phibe_s00001g00026.1, was screened out, and a set of primers with the most specific and high sensitivity was designed based on this target, that is, the one described in Example 1. The primer composition used (upstream primer Phi-F and downstream primer Phi-R). Using the primers designed for the remaining 5 detection targets, the specificity of the PCR test results shows that the specificity is not high. Taking the target Phibe_s00001g00031.1 as an example, the actual primer sequence is: Phi-31F: 5'-TCCGGGTGCTGGGAACTCCG-3' (SEQ ID NO: 6); Phi-31R: TCAGCCAGGTGGGAACATTA-3' (S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection target Phibe_s00001g00026.1 of Phytophthora winteris and its detection primer and detection method. The DNA sequence of the detection target Phibe_s00001g00026.1 is shown in SEQ ID NO: 1, and the CDS sequence is shown in SEQ ID NO: 2 Shown, the protein sequence is shown in SEQ ID NO:3. The detection primer consists of its forward primer sequence as shown in SEQ ID NO:4 and its reverse primer sequence as shown in SEQ ID NO:5. The detection target excavated by the present invention and the primer combination designed by it are used in ordinary PCR with strong specificity and high sensitivity, which proves that Phibe_s00001g00026.1 is suitable as the detection target of Phytophthora winteris, and the target and detection method established by the present invention are suitable for Chinese ports The winter Phytophthora carried on imported fruits and seedlings can be inspected and prevented immediately, which plays an important role in protecting my country's ecological security.

Description

technical field [0001] The invention belongs to the technical field of gene detection, and in particular relates to a specific detection target Phibe_s00001g00026.1 of Phytophthora winteris and its application. Background technique [0002] Phytophthora (Phytophthora), once any plant is infected by it, it will be doomed and the damage will be serious. So, the Latin Phytophthora is described as: Destroyer of plants. Phyto, in the original Greek, means plant, and phthora means destruction. There are more than 100 species of Phytophthora (Phytophthora) officially reported, and many Phytophthora have records of seriously endangering agricultural production safety. It can be said that all of them are destroyers of crops. Production loss, or even extinction. Therefore, it is of great significance to prevent foreign harmful quarantine Phytophthora from being introduced into our country. my country's entry quarantine list includes P. Potato Phytophthora scarlet rot P.erythrosept...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/04C12Q1/686C12N15/11C12R1/645
CPCC12Q1/686C12Q1/6895
Inventor 戴婷婷汪澳华胡涛严娟廖婷婷于潇玮陈贞鹏
Owner NANJING FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More