Vector for editing tomato yellow leaf curl China virus (TYLCCNV) on basis of CRISPR/Cas9 system, and construction method and application of vector
A technology of tomato yellowing and curved leaves and construction methods, applied in the direction of biochemical equipment and methods, applications, botany equipment and methods, etc., can solve the problems of no specificity, difficulty in field control, and unsatisfactory plant disease resistance, etc. To achieve the effect of improving the scope of application, preventing virus replication, and high innovation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0063] Such as Figure 1-3 As shown, the vectors for editing Chinese tomato yellow leaf curl virus based on the CRISPR / Cas9 system: pCambia 1300-BKG-g4, pCambia1300-BKG-g5 and pCambia 1300- BKG-g6, referred to as BKG-g4, BKG-g5 and BKG-g6;
[0064] It also includes pCambia1300-BKG-g1, pCambia 1300-BKG-g2 and pCambia 1300-BKG-g3 constructed against the Iteron region of Chinese tomato yellow leaf curl virus beta (TYLCCNB), referred to as BKG-g1, BKG-g2 and BKG- g3.
[0065] Its construction method includes the following steps:
[0066] (1) Select the PAM site near the Iteron region of the TYLCCNV sequence and design gRNA; including six gRNA strands of the three targets required by the BKG-g4, BKG-g5, and BKG-g6 vectors: g4-A / B , g5-A / B, g6-A / B; its sequence is shown in SEQID: NO.1-NO.6;
[0067] g4-A:TGATTGAATTGGTGTCTCTCAAACT
[0068] g4-B:AAACAGTTTGAGAGACACCAATTCA
[0069] g5-A:TGATTGGCTATGCAATCGGTGTCTG
[0070] g5-B:AAACCAGACACCGATTGCATAGCCA
[0071] g6-A:TGATTGCTGGGGT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com