Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vector for editing tomato yellow leaf curl China virus (TYLCCNV) on basis of CRISPR/Cas9 system, and construction method and application of vector

A technology of tomato yellowing and curved leaves and construction methods, applied in the direction of biochemical equipment and methods, applications, botany equipment and methods, etc., can solve the problems of no specificity, difficulty in field control, and unsatisfactory plant disease resistance, etc. To achieve the effect of improving the scope of application, preventing virus replication, and high innovation

Inactive Publication Date: 2020-05-08
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previously, by using Cas9 technology to target the IR region of other geminiviruses, the disease resistance of plants obtained was not satisfactory
Under the current conditions, there are still many constraints in the prevention and control of geminiviruses in the field: (1) plant viruses are known as "plant cancers", and field control is difficult. Due to the unsatisfactory biological, physical and chemical control effects, there are currently many anti-virus projects in the field. Focus on prevention and combine prevention and control; (2) Geminiviruses mostly rely on insect vectors for transmission, so controlling crops in the field to eat insects is the most effective way to cut off its transmission route, so that large-scale use of chemical reagents cannot be avoided, and pesticide residues Problems and non-target biosafety issues are in front of people, and it is difficult to solve in a short period of time; (3) In terms of breeding, the breeding of geminivirus-resistant crop varieties is slow, and the field effect is not ideal, and there are potentially great uncertain factors
(4) At present, the use of CRISPR / Cas9 technology to edit plant virus sequences mostly selects in the IR region of geminiviruses, and the antiviral effects vary greatly among different viruses, and there is no good specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector for editing tomato yellow leaf curl China virus (TYLCCNV) on basis of CRISPR/Cas9 system, and construction method and application of vector
  • Vector for editing tomato yellow leaf curl China virus (TYLCCNV) on basis of CRISPR/Cas9 system, and construction method and application of vector
  • Vector for editing tomato yellow leaf curl China virus (TYLCCNV) on basis of CRISPR/Cas9 system, and construction method and application of vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0063] Such as Figure 1-3 As shown, the vectors for editing Chinese tomato yellow leaf curl virus based on the CRISPR / Cas9 system: pCambia 1300-BKG-g4, pCambia1300-BKG-g5 and pCambia 1300- BKG-g6, referred to as BKG-g4, BKG-g5 and BKG-g6;

[0064] It also includes pCambia1300-BKG-g1, pCambia 1300-BKG-g2 and pCambia 1300-BKG-g3 constructed against the Iteron region of Chinese tomato yellow leaf curl virus beta (TYLCCNB), referred to as BKG-g1, BKG-g2 and BKG- g3.

[0065] Its construction method includes the following steps:

[0066] (1) Select the PAM site near the Iteron region of the TYLCCNV sequence and design gRNA; including six gRNA strands of the three targets required by the BKG-g4, BKG-g5, and BKG-g6 vectors: g4-A / B , g5-A / B, g6-A / B; its sequence is shown in SEQID: NO.1-NO.6;

[0067] g4-A:TGATTGAATTGGTGTCTCTCAAACT

[0068] g4-B:AAACAGTTTGAGAGACACCAATTCA

[0069] g5-A:TGATTGGCTATGCAATCGGTGTCTG

[0070] g5-B:AAACCAGACACCGATTGCATAGCCA

[0071] g6-A:TGATTGCTGGGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vector for editing tomato yellow leaf curl China virus (TYLCCNV) on the basis of a CRISPR / Cas9 system, and a construction method and an application of the vector. The vectorcomprises pCambia 1300-BKG-g4, pCambia 1300-BKG-g5 and pCambia 1300-BKG-g6 which are constructed for a replication core region (an Iteron region) of the tomato yellow leaf curl China virus (TYLCCNV);and the vector also comprises pCambia 1300-BKG-g1, pCambia 1300-BKG-g2 and pCambia 1300-BKG-g3 which are constructed for the Iteron region of tomato yellow leaf curl China virus beta (TYLCCNB). The vector provided by the invention depends on a CRISPR / Cas9 system, can realize fixed-point editing of a TYLCCNV / TYLCCNB sequence, and has high editing efficiency.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for constructing a vector based on the CRISPR / Cas9 system target and editing the replication core region of Chinese tomato yellow leaf curl virus to inhibit geminivirus infection. Background technique [0002] Tomato yellow leaf curl China virus (Tomato yellow leaf curl China virus, TYLCCNV) belongs to Geminiviridae, Bean golden mosaic virus genus virus. The virus is often accompanied by the satellite molecule Tomato yellow leaf curl China betasatellite (TYLCCNB) in the field. The disease complex formed after the combined infection of TYLCCNV and TYLCCNB has caused destruction to vegetable crops such as tomatoes in the field in my country. sexual hazards. The virus is mainly transmitted by Bemisia tabaci, and the infected tomato plants grow slowly or stagnate, with serious dwarfing, new leaves chlorotic, yellow, smaller, and curled at the edges. At present, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/83C12N15/66C12N15/113A01H5/00A01H6/82
CPCC12N15/113C12N15/8218C12N15/8283C12N2310/20
Inventor 周雪平李方方李浩龚攀
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products