Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for identifying 2'-O-methylation modification in RNA molecules and application thereof

A methylation and molecular technology, applied in biochemical equipment and methods, analytical materials, biological material analysis, etc., can solve the problems of large sample requirements and low sensitivity, and achieve high sensitivity, simple operation, and mild reaction conditions Effect

Inactive Publication Date: 2020-05-26
METHYCURE BIOTECH CORP
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above methods for detecting miRNA methylation still have the disadvantages of low sensitivity and large sample requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying 2'-O-methylation modification in RNA molecules and application thereof
  • Method for identifying 2'-O-methylation modification in RNA molecules and application thereof
  • Method for identifying 2'-O-methylation modification in RNA molecules and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1 recombinant protein expression and purification

[0053] Entrust Invitrogen to synthesize the RNase R gene sequence and remove the first 81 amino acid truncated gene sequences (SEQ ID NO: 1 and 2), and introduce NcoI endonuclease site at the 5' end of the gene fragment, and introduce HindIII at the 3' end endonuclease site. The synthesized gene fragment and the pET28a(+) vector were digested with NcoI and HindIII, respectively, and the gene fragment and the vector fragment were ligated using T4DNA ligase, and routinely transformed into DH5α competent cells (Tiangen Biochemical Technology (Beijing) Co., Ltd.). Positive clones were screened according to kanamycin resistance, and plasmids were extracted. The recombinant plasmid was identified by NcoⅠ and HindⅢ double enzyme digestion and agarose gel electrophoresis. Invitrogen Company was entrusted to sequence the recombinant plasmid. BioEdit software was used to analyze the sequencing results. The result was...

Embodiment 2

[0063] The preparation of embodiment 2 small molecule RNA substrates

[0064] Commissioned Invitrogen to synthesize single-stranded small RNA (miR-21) (SEQ ID NO: 5) with the same sequence: one without any additional modification (miR-21), one with 2'-O at the 3' end - Methylation modification (miR-21-ch3). They were diluted to 100 nmol and stored at -20°C in the dark.

[0065] SEQ ID NO: 5 artificially synthesized single-stranded small RNA UAGCUUAUCAGACUGAUGUUGA

Embodiment 3

[0066] Example 3 Rnase R enzyme degradation reaction and electrophoresis detection

[0067] Mix 10 μg, 5 μg, or 2.5 μg of the recombinant fusion protein obtained in Example 1 with 7 μL of the diluted RNA substrate obtained in Example 2, add an appropriate amount of buffer solution and water to a final volume of 10 μL (20 mM Tris pH 8.5, 100 mM KCl ,0.01mM ZnCl 2 ), react at 37°C for 1 hour, and then treat at 85°C for 5 minutes to inactivate the enzyme. Afterwards, the product was separated on a 10% TBE-urea gel.

[0068] see results figure 2 . In the control group using enzyme buffer, the RNA substrates were clearly displayed on the gel regardless of whether the 3' end was modified or not. After reacting with three different concentrations of RNase R enzyme, the 2'-O-methylated RNA substrate at the 3' end was also clearly displayed on the gel. After reacting with three different concentrations of RNase R enzyme, the RNA substrate without modification at the 3' end has be...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for identifying whether an RNA molecule has 2'-O-methylation modification on nucleotide. The method comprises the following steps: (1) enabling the RNA molecule to be in contact with ribonuclease Rnase R; and (2) detecting whether the RNA molecule is degraded or not or detecting the hydrolysis stopping position after the RNA molecule is degraded; wherein, if the RNAmolecule is degraded, the RNA molecule does not have 2'-O-methylation modification on a 3'-terminal nucleotide; and if the plurality of randomly broken fragments are all terminated to hydrolyze at the same site, the RNA molecule has 2'-O-methylation modification on the nucleotide at one site of the termination site. The invention also provides an application of the method in screening disease diagnosis targets and confirming whether a subject has diseases related to 2'-O-methylation modification, and the method provided by the invention has the advantages of high sensitivity, mild reaction conditions and simple operation.

Description

technical field [0001] The present invention relates to a method for identifying whether an RNA molecule has 2'-O-methylation modification and determining a 2'-O-methylation modification site, and also relates to the use of these methods in determining a disease diagnosis target and determining whether a subject has Applications in diseases related to 2'-O-methylation modification. Background technique [0002] Since the first pseudouridine was discovered more than 50 years ago, more than 100 different RNA modifications have been identified in the biological world so far, and these modifications mainly occur in the four nucleosides of newly generated precursor RNAs base, and widely exists in various RNA molecules, including transfer RNA, ribosomal RNA, messenger RNA and various small RNAs. A large number of studies have shown that plant small RNA (miRNA) also has various modifications such as uridine and methylation, and participates in the regulation of miRNA production an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/34C12Q1/6869
CPCC12Q1/34C12Q1/6869C12Q2535/122C12Q1/68C12N9/22C12Q1/6886C12Q2600/178G01N2333/922G01N33/57423C12Q2521/327C12Q2525/207
Inventor 陈奇涵
Owner METHYCURE BIOTECH CORP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com