Cell strain capable of stably expressing AMPA receptor GluR1/GluR2, and construction method of cell strain

A construction method and stable expression technology, applied in the field of genetic engineering, can solve problems such as loss of exogenous genes in cells

Inactive Publication Date: 2020-06-12
湖南大学深圳研究院
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the exogenous gene of cells infected by this method will be lost with passage;

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell strain capable of stably expressing AMPA receptor GluR1/GluR2, and construction method of cell strain
  • Cell strain capable of stably expressing AMPA receptor GluR1/GluR2, and construction method of cell strain
  • Cell strain capable of stably expressing AMPA receptor GluR1/GluR2, and construction method of cell strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Transient expression verification

[0041] By constructing pCAG-3×Flag-GluR1 and pCAG-Myc-GluR2 vectors, PEI transfection reagents were used to transfect Hela cells, so that the target gene was expressed in a short but high level in Hela cell lines, and then the cells were detected by immunofluorescence technology. Localize the target protein expressed in the cell to detect whether the target protein is expressed correctly.

[0042]Using the pCAG-pHluorin-GluR1-Yong plasmid as the backbone, EcoRI and KpnI endonuclease cleavage treatment removes the pHluorin protein to form a linear vector with cohesive ends. The pCAG-3×Flag-GluR1 and pCAG-Myc-GluR2 vectors were constructed by PCR amplification; the constructed plasmids were transfected into Hela cells with PEI (Polysciences, USA) transfection reagent, and cultured at 37°C and 5% CO2 for 48 After 1 hour, the total cell protein was collected, and the expression of GluR1 and GluR2 was detected by Western Blot. ...

Embodiment 2

[0044] Embodiment 2 Construction of stable expression vector

[0045] The pQCXIH plasmid was used as the backbone vector, and the pCAG-3×Flag-GluR1 and CAG-Myc-GluR2 constructed above were used as templates to construct the pQCXIH-3×Flag-GluR1 and pQCXIH-Myc-GluR2 lentiviral retroviral vectors.

[0046] According to the CDS sequence of GluR1 and GluR2 and the multiple cloning site of the vector pQCXIH, primers retaining restriction sites (Not I and BamH I) are designed, and the signal peptide (GluR1 Signal peptide sequence: ATGCCGTACATCTTTGCCTTTTTCTGCACCGGTTTTTAGGTGCGGTTGTGGGTGCCAAT; GluR1 signal peptide sequence: ATGCAAAAGATTATGCATATTCTGTCCTCCTTTCTCCTGTTTTATGGGGACTGATTTTTGGTGTCTCTGCGCGC). After retroviral packaging of the constructed pQCXIH-3×Flag-GluR1 and pQCXIH-Myc-GluR2 recombinant vectors, the obtained pseudovirus was used to infect Hela cells, and 250ng / μl hygromycin B was added to screen to obtain stable expression AMPA receptor GluR1 / GluR2 cell line.

[0047] The sp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering, particularly to a GluR1 / GluR2 cell strain capable of stably expressing an AMPA receptor, and a construction method thereof. Accordingto the construction method disclosed by the invention, a cell strain capable of stably expressing an AMPA receptor GluR1 / GluR2 is prepared. According to the scheme, retrovirus mediated gene expressionis adopted, hygromycin B is added for screening for two weeks, and the cell strain stably expressing the AMPA receptor GluR1 / GluR2 is obtained; after the AMPA receptor GluR1 / GluR2 stably transfectedcell strain is subjected to passage six times, the GluR1 and the GluR2 in the cell strain are still stably expressed, and the GluR1 and the GluR2 interact with each other; and the cell strain can provide basic research materials, experimental tools and carriers for analysis of AMPA receptor functions in diseases such as cerebral apoplexy and the like and probe development.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a GluR1 / GluR2 cell line stably expressing AMPA receptors and a construction method thereof. Background technique [0002] AMPA receptor (α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptor, α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor, AMPAR), is Ligand-gated channel ionotropic receptors that regulate fast excitatory postsynaptic transmission in the central nervous system. The number and location of AMPARs in the hippocampal region of the brain, the different functional structures of AMPAR subunits, and different intracellular-C-terminal interacting proteins play different roles in the process of LTP and LTD, thereby mediating the human Learning, memory and cognitive activities. Furthermore, aberrant AMPAR trafficking and hyperactivation are associated with many neurodegenerative diseases. Regulating the transport of AMPARs has become a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N5/10
CPCC12N5/0693C12N15/86C12N2510/00C12N2740/10043C12N2800/107
Inventor涂海军
Owner湖南大学深圳研究院