RPA primer, probe and kit for detecting TiLV of tilapia
A tilapia and kit technology, applied in the fields of DNA/RNA fragments, microorganisms, recombinant DNA technology, etc., can solve problems such as the lack of effective prevention and treatment of TiLV, and achieve the effect of high accuracy and simple operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Designing RPA primers and probe structures based on the ORF10 gene of Luohu virus
[0024] (1) The sequence of TiLV-ORF10 is, as shown in sequence 4:
[0025] GCAAATCTTTCCCTCTGACACCCTGTATAGTTAGCGTTGGCCTGTGGATACGAACGAAATCAGAACCGATATTAAGGTGCTAAGACTGCACGTCAAGAGACTTCTTTCCGAAATCTTCGGAAAATCGAGATAGGTCACTCTGCCCATCATCCTCTCTGTCCCTTCTGTTTTTGGGATTGAAATCAACCCTAGCCCACTCTGGGATTGCAGAATCACAGTCGTCCATCTCGAGGTCGACTTCGTCACCCCACTCTATATTATCTTCACCGCTCTCGTCAGCACCATACCTTTCATTCTTCCAACTTCGCTTCTTTGAAGCAGCTTTCTTGCCCTTCTTGATCTTCCGACTTCTTAGTACTAAACATCCTGAGCTCTCAGCCCCCGAGTCACTGTCACTTGACAAATAATCTGCCACACTCATCCTGGCTTATAGCTATATTTGGTGTTAGTAGGGTTAAAATTTGG。
[0026] (2) As shown in sequences 1 and 2, the nucleotide sequence of the RPA primer is:
[0027] Upstream primer ORF10-F: 5'-TTTCCCTCTGACACCCTGTATAGTTAGCGT-3';
[0028] Downstream primer ORF10-R: 5'-AACCCTACTAACACCAAATATAGCTATAAGC-3'.
[0029] (3) As shown in sequence 3, the probe structure is designed based on the ORF10 gene of Luohu virus,...
Embodiment 2
[0032] Embodiment 2: A kind of RPA kit and using method for detecting Tilapia TiLV
[0033] (1) The kit includes the RPA reaction amplification system: a total of 50 μL, 4 μL of upstream primer ORF10-F, 4 μL of downstream primer ORF10-R, 2 μL of probe P, 200 ng of nucleic acid template, and rehydration buffer (Rehydration Buffer) 29.5 μL, 2.5 μL magnesium acetate solution (280 mmol / L), and deionized water as the balance.
[0034] (2) The method of use is as follows:
[0035] S1, extracting the total RNA and cDNA synthesis of the virus to be tested.
[0036] S2, RPA amplification reaction.
[0037] The reaction system is as follows: the total amount is 50 μL, add 4 μL upstream primer ORF10-F, 4 μL downstream primer ORF10-R, 2 μL Probe P, 200 ng of nucleic acid template, 29.5 μL of rehydration buffer (Rehydration Buffer), 2.5 μL of magnesium acetate solution (280 mmol / L), and deionized water as the balance.
[0038] Mix the RPA amplification system well, centrifuge at 5,000×...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com