nf-yb9 mutant gene and its protein and application

A NF-YB9, 1.NF-YB9 technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as the study of transcription factor NF-YB9 deletion, and achieve great application value and increase in grain length.

Active Publication Date: 2021-08-13
YANGZHOU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] So far, there is no report on the research on the loss of function of the transcription factor NF-YB9 and its application in rice breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • nf-yb9 mutant gene and its protein and application
  • nf-yb9 mutant gene and its protein and application
  • nf-yb9 mutant gene and its protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Obtaining of Genetically Engineered Bacteria of CRISPR / Cas9-NF-YB9 Carrier

[0048] 1. CRISPR / Cas9 target design

[0049] The CRISPR Primer Designer online software package (http: / / skl.scau.edu.cn / ) developed by Yaoguang Liu was used for target selection.

[0050] In order to efficiently obtain knockout mutant materials, the present invention simultaneously synthesizes and utilizes two guide sequences (Guide Sequence) required for editing NF-YB9 to conduct fixed-point editing on NF-YB9, and the guide sequence bases used are:

[0051] NF-YB9-gRNA1: ATGGAGCCCGCATTTCCCAA (+1bp~+20bp, base 1 to base 20 of NF-YB9 gene)

[0052] And NF-YB9-gRNA2: CGAACGTGATCCGCATCATG (-17bp~+3bp, the 17th base upstream of the ATG start codon of the NF-YB9 gene to the 3rd base of the NF-YB9 gene)

[0053] 2. CRISPR / Cas9 vector construction

[0054] Use overlapping PCR (Overlapping) to connect the target fragment to the intermediate carrier pYLsgRNA-OsU6a plasmid DNA (plasmid DNA i...

Embodiment 2

[0063] The acquisition of embodiment 2 transgenic rice

[0064] 1, culture medium formula among the present invention:

[0065] Induction medium MSD (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; 2,4-D, 2.0mg / L; Agar, 0.8%;

[0066] Infection solution Liquid MSD (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; 2,4-D, 2.0mg / L;

[0067] Carbenicillin 400mg / L; PPM 1ml / L;

[0068] Co-culture medium MSD+S+AS (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; 2,4-D, 2.0mg / L; Sorbitol, 5%; Agar, 1.4%;

[0069] Screening medium MSD+CH+PPM (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; 2,4-D, 2.0mg / L; Agar, 0.8%; Hygromycin B, 50mg / L ; Carbenicillin, 250mg / L; PPM, 1ml / L;

[0070] Differentiation medium BN+S+CH (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; Sorbitol, 5%; BAP, 3mg / L; NAA, 0.5mg / L; Agar, 0.8% ; Hygromycin B, 50mg / L; Carbenicillin, 125mg / L.

[0071] Root growth medium MS+H (pH5.8); MS media4.4g / L; Sucrose30g / L; Agar0.8%; Hygromycin B50mg / L; Carbenicillin 50mg / L;

[0072] 2, callus induction,...

Embodiment 3

[0080] Example 3 Identification of Target Gene Mutation Position and Mutation Form

[0081] Design primers to amplify the CRISPR / Cas9 editing site region, and the primer sequences are:

[0082] NF-YB9-sF: (-204) GTAGTGAAGGAAGTGCAATAAA (-183);

[0083] NF-YB9-sR: (+270)CCATGGCCCAGACGAGGT(+298);

[0084] The DNA of the transgenic material of the above 17 transgenic lines and the wild-type untransformed material Kitaake leaves were extracted respectively, PCR amplification was performed using the above primers, the PCR products were sequenced, and the DNA sequences of the wild-type Kitaake material and the above-mentioned transgenic material edited by CRISPR / Cas9 were compared , judge the mutation site and mutation type according to the sequencing profile. If the sequencing profile is single and has base deletions, insertions, or substitutions compared with the control, it is a homozygous mutant for the corresponding base deletions, insertions, and substitutions; if If there ar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to the function and application of rice NF-Y transcription factor family mutant gene NF-YB9 and its encoded protein. The present invention finds that the rice gene NF-YB9 and its encoded protein are involved in the regulation of rice grain development, and the length of the rice grain can be significantly increased by destroying the biological function of the protein encoded by the NF-YB9 gene. The present invention utilizes CRISPR / Cas9 technology to realize high-efficiency fixed-point editing of NF-YB9 gene, and the rice grain length increases significantly after NF-YB9 function is lost. The new function of the rice NF-Y transcription factor family gene NF-YB9 provided by the invention provides a candidate gene for plant breeding, and has very important application value in agricultural production.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to NF-YB9 mutant gene and its protein and application. Background technique [0002] Rice is currently the most important food crop at home and abroad, and improving rice yield is the main purpose of plant science research. With the continuous increase of my country's population, the reduction of arable land and natural resources, and the deterioration of the environment, improving rice yield and quality is still a major demand to ensure my country's food security and social stability. [0003] Grain weight, number of grains per panicle and number of panicles per plant are the three components that determine rice yield, and grain weight is determined by grain length, grain width and grain thickness. Grain length not only becomes the breeding target as an important yield trait, but also affects the quality and appearance of rice such as rice milling rat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/10A01H6/46C12Q1/6895G01N33/68
CPCC07K14/415C12N15/8218C12N15/8261C12Q1/6895C12Q2600/13G01N33/68
Inventor 牛百晓张真雨张娟魏雪枫陈忱
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap