nf-yb9 mutant gene and its protein and application
A NF-YB9, 1.NF-YB9 technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as the study of transcription factor NF-YB9 deletion, and achieve great application value and increase in grain length.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 Obtaining of Genetically Engineered Bacteria of CRISPR / Cas9-NF-YB9 Carrier
[0048] 1. CRISPR / Cas9 target design
[0049] The CRISPR Primer Designer online software package (http: / / skl.scau.edu.cn / ) developed by Yaoguang Liu was used for target selection.
[0050] In order to efficiently obtain knockout mutant materials, the present invention simultaneously synthesizes and utilizes two guide sequences (Guide Sequence) required for editing NF-YB9 to conduct fixed-point editing on NF-YB9, and the guide sequence bases used are:
[0051] NF-YB9-gRNA1: ATGGAGCCCGCATTTCCCAA (+1bp~+20bp, base 1 to base 20 of NF-YB9 gene)
[0052] And NF-YB9-gRNA2: CGAACGTGATCCGCATCATG (-17bp~+3bp, the 17th base upstream of the ATG start codon of the NF-YB9 gene to the 3rd base of the NF-YB9 gene)
[0053] 2. CRISPR / Cas9 vector construction
[0054] Use overlapping PCR (Overlapping) to connect the target fragment to the intermediate carrier pYLsgRNA-OsU6a plasmid DNA (plasmid DNA i...
Embodiment 2
[0063] The acquisition of embodiment 2 transgenic rice
[0064] 1, culture medium formula among the present invention:
[0065] Induction medium MSD (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; 2,4-D, 2.0mg / L; Agar, 0.8%;
[0066] Infection solution Liquid MSD (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; 2,4-D, 2.0mg / L;
[0067] Carbenicillin 400mg / L; PPM 1ml / L;
[0068] Co-culture medium MSD+S+AS (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; 2,4-D, 2.0mg / L; Sorbitol, 5%; Agar, 1.4%;
[0069] Screening medium MSD+CH+PPM (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; 2,4-D, 2.0mg / L; Agar, 0.8%; Hygromycin B, 50mg / L ; Carbenicillin, 250mg / L; PPM, 1ml / L;
[0070] Differentiation medium BN+S+CH (pH5.8): MS media, 4.4g / L; Sucrose, 30g / L; Sorbitol, 5%; BAP, 3mg / L; NAA, 0.5mg / L; Agar, 0.8% ; Hygromycin B, 50mg / L; Carbenicillin, 125mg / L.
[0071] Root growth medium MS+H (pH5.8); MS media4.4g / L; Sucrose30g / L; Agar0.8%; Hygromycin B50mg / L; Carbenicillin 50mg / L;
[0072] 2, callus induction,...
Embodiment 3
[0080] Example 3 Identification of Target Gene Mutation Position and Mutation Form
[0081] Design primers to amplify the CRISPR / Cas9 editing site region, and the primer sequences are:
[0082] NF-YB9-sF: (-204) GTAGTGAAGGAAGTGCAATAAA (-183);
[0083] NF-YB9-sR: (+270)CCATGGCCCAGACGAGGT(+298);
[0084] The DNA of the transgenic material of the above 17 transgenic lines and the wild-type untransformed material Kitaake leaves were extracted respectively, PCR amplification was performed using the above primers, the PCR products were sequenced, and the DNA sequences of the wild-type Kitaake material and the above-mentioned transgenic material edited by CRISPR / Cas9 were compared , judge the mutation site and mutation type according to the sequencing profile. If the sequencing profile is single and has base deletions, insertions, or substitutions compared with the control, it is a homozygous mutant for the corresponding base deletions, insertions, and substitutions; if If there ar...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com