The gene osabcg42 regulating cadmium accumulation in rice, its encoded protein and its application

A technology for encoding protein and rice cadmium, applied in the field of the gene OsABCG42 and its encoded protein that regulates the accumulation of rice cadmium, to achieve the effect of simple operation, short cycle, and improved cadmium accumulation characteristics

Active Publication Date: 2022-05-17
HUNAN HYBRID RICE RES CENT
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are relatively few reports on the involvement of other ABC transporters in rice cadmium regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The gene osabcg42 regulating cadmium accumulation in rice, its encoded protein and its application
  • The gene osabcg42 regulating cadmium accumulation in rice, its encoded protein and its application
  • The gene osabcg42 regulating cadmium accumulation in rice, its encoded protein and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] A gene OsABCG42 regulating rice cadmium accumulation of the present invention has a nucleotide sequence of its coding region as shown in SEQ ID NO: 1, specifically:

[0034]ATGATACTGGGATTGGATATATGCGCGGACACGATCGTCGGCGACCAGATGCAGAGGGGGATCTCCGGTGGTCAGAAGAAACGCGTCACCACCGGTGAGATGATTGTCGGTCCAACAAAGGTTCTATTCATGGATGAGATATCAACTGGATTGGACAGCTCCACCACATTCCAGATTGTCAAATGCCTTCAGCAAATCGTGCACTTGGGCGAGGCAACCATCCTCATGTCACTCCTACAACCAGCCCCTGAGACTTTTGAGCTATTCGATGACATTATCCTACTGTCAGAAGGCCAGATTGTTTATCAGGGACCCCGCGAATACGTCCTTGAGTTCTTTGAGTCATGCGGATTCCGCTGCCCAGAGCGTAAGGGTACTGCAGACTTTCTTCAGGAGGTGACATCAAAGAAGGATCAGGAGCAGTATTGGGCCGACAAGCATAGGCCATACAGATACATTTCAGTCTCAGAATTTGCACAGAGATTTAAAAGGTTCCATGTTGGGCTCCAACTTGAGAATCATCTCTCAGTCCCATTTGATAAAACTCGTAGCCATCAGGCTGCTCTTGTCTTCTCGAAGCAATCGGTGTCAACAACAGAGCTCCTCAAGGCATCCTTTGCCAAGGAGTGGCTCCTCATTAAGCGCAACTCATTTGTGTACATCTTCAAGACCATACAGCTCATCATTGTAGCCCTTGTCGCGTCGACAGTGTTTCTTAGGACCCAGATGCACACAAGGAATTTAGATGATGGCTTTGTGTACATTGGAGCACTACTTTTCAGTCTGATTGTGAACATGTTCAATGGTTTCGCTG...

Embodiment 2

[0038] Example 2: Obtainment and molecular identification of OsABCG42 knockout strain

[0039] A method for suppressing the expression of the gene OsABCG42 of the present invention specifically comprises: editing the CDS of the OsABCG42 gene by CRISPR / Cas9 to cause a nonsense mutation in OsABCG42. The specific implementation method is as follows:

[0040] (1) According to the selection principle of the target site of the CRISPR / Cas9 vector system, two 20bp sequences were selected in the third exon of OsABCG42 as the target sequence for the generation of sgRNA.

[0041] The first target sequence is located in the antisense strand 189-208bp downstream of the start codon ATG in the coding region of the OsABCG42 gene, and the sequence is CCAAGTGCACGATTTGCTGA (as shown in SEQ ID NO: 3);

[0042] The second target sequence is located in the antisense strand 317-336 bp downstream of the start codon ATG in the coding region of the OsABCG42 gene, and the sequence is GAACTCAAGGACGTATTC...

Embodiment 3

[0059] Example 3: Element content and main agronomic traits of OsABCG42 gene knockout lines

[0060] Detection of Cd content in aerial parts and roots of OsABCG42 knockout lines: OsABCG42 knockout lines osabcg42-1, osabcg42-2 and wild-type control Huazhan were sown in 96-well PCR plates with the bottom cut off after soaking and accelerating germination. Nutrient solution cultured for 14 days, with 0.2, 0.5μM CdCl 2 Treat for 10 days, rinse with tap water and deionized water three times, separate the aboveground part from the root system, dry at 80°C until constant weight, crush, weigh, and use HNO 3 -HClO 4 The mixture was digested, and the Cd content in aerial parts and roots was measured by inductively coupled plasma mass spectrometer (ICP-MAS).

[0061] The result is as figure 2 As shown in the figure, it can be seen from the figure that the cadmium content in the aerial parts and roots of the knockout lines osabcg42-1 and osabcg42-2 were significantly reduced under the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene OsABCG42 regulating rice cadmium accumulation and its encoded protein and application. The nucleotide sequence of the gene OsABCG42 is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2. The present invention uses gene editing, EMS mutagenesis, radiation mutagenesis, aerospace loading and other mutagenesis techniques to mutate the gene OsABCG42 to improve the cadmium accumulation characteristics of existing rice. Combined with molecular marker-assisted selection, multi-gene aggregation can also be achieved to create rice varieties with low cadmium content in rice. The operation is simple, the cycle of improving and cultivating new varieties is short, and the main agronomic traits are not affected.

Description

technical field [0001] The invention relates to the technical field of rice genetic engineering, in particular to the gene OsABCG42 regulating rice cadmium accumulation, its encoded protein and its application. Background technique [0002] Rice is one of the most important food crops in my country, and more than half of the population uses rice as a staple food. In recent years, the problem of excessive cadmium in rice caused by cadmium pollution in cultivated land has aroused widespread concern in the society. According to the 2014 National Soil Pollution Survey Bulletin, the rate of cadmium (Cd) pollution in cultivated land in my country has reached 7%. In southern China, the rate of cadmium exceeding the standard in rice reaches 23%, and the safe production of rice is seriously threatened. The cadmium enriched in rice can enter the human body through the food chain and endanger human health. The problem of regulating and reducing cadmium content in rice needs to be so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8218C12N15/8271
Inventor唐丽赵炳然孙远涛李曜魁吕启明胡远艺董家瑜
OwnerHUNAN HYBRID RICE RES CENT