Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of hsa_circ_0007444 in preparation of medicine for treating ovarian cancer

A kind of ovarian cancer, ovarian epithelial cancer technology, applied in the application field of medicine

Active Publication Date: 2020-09-04
NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the field of ovarian cancer research, circRNA research is still in its infancy, and only three circRNA functions in ovarian cancer have been annotated[6-8]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of hsa_circ_0007444 in preparation of medicine for treating ovarian cancer
  • Application of hsa_circ_0007444 in preparation of medicine for treating ovarian cancer
  • Application of hsa_circ_0007444 in preparation of medicine for treating ovarian cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] RNA extraction, PCR and sanger sequencing

[0033] The total RNA of the cells was extracted according to the Trizol extraction instructions, and about 3000ngRNA was incubated with 3U / 1000ng RNaseR and 1U / 1000ng DNase I at 37°C for 15 minutes, and then the RNA was purified with the RNeasy MinEluteCleanup Kit from QIAGEN, according to the reverse reaction of Thermo Fisher. The instructions for the transcription kit reverse transcribe the RNA into cDNA. Use the primers located at the interface to amplify the full-length has_circ_0007444 (circ_0007444-jF: ATTCAGGTGCTTTTCAGTGGGA (SEQ ID NO.1), has_circ_0007444-jR: CGCTTCAGCCTTTAAGACAGG (SEQ ID NO.2)) for PCR amplification, and then send it to GenScript The company performs Sanger sequencing.

[0034] circRNA localization analysis

[0035] The RNA in the nucleus and cytoplasm of ovarian cancer cells was extracted using Invitrogen's PARIS KIT, and the RNA was reverse-transcribed into cDNA according to the instructions of the...

Embodiment 2

[0038] cell culture

[0039] The ovarian cancer cell line SKOV3 was purchased from the Cell Bank of Shanghai Chinese Academy of Sciences, and A2780 cells and HO8910 cells were purchased from Jiangsu KGI Biotechnology Co., Ltd. SKOV3 cells were cultured in McCoy's 5A+10% FBS+1% double antibody, A2780 cells and HO8910 cells were cultured in DMEM+10% FBS+1% double antibody. The culture condition is 5% CO 2 , 37°C.

[0040] Vector construction and cell transfection

[0041] Design and synthesize has_circ_0007444 full-length primers, primer sequences: has_circ_0007444-qF:TTCTCTGCGCTGTAAGCCATGT (SEQ ID NO.9), has_circ_0007444-qR:AACGATCTTGTGGGCCTCTACA (SEQ ID NO.10), using the cDNA of SKOV3 cells as a template, PCR amplification products, respectively Cloned to the overexpression lentiviral vector GPLVX-Mini-GFP-Puro after EcoRI and BamHI double digestion (see the plasmid spectrum figure 1 ), carry out agarose gel electrophoresis on the digested product, after the electrophoresi...

Embodiment 3

[0053] siRNA synthesis and transfection

[0054] The siRNAs were synthesized by Guangzhou Ruibo Biotech Co., Ltd., and the sequences were si-h-has-circ-0007444-si1:ACACCAGGAAAGAAAAAAT (SEQ ID NO.17), si-h-has-circ-0007444-si2:CCAGGAAAGAAAAAATGCC (SEQ ID NO.18), si-h-has-circ-0007444-si3: AAAGAAAAAATGCCTGTCT (SEQ ID NO.19). Transfection was performed according to the instruction manual of lipo2000, and the knockdown efficiency was detected by qRT-PCR. .Transient has_circ_0007444 specific siRNA, qRT-PCR results showed that the knockdown efficiency of siRNA-1 and siRNA-2 on has_circ_0007444 in HO8910 cells and SKOV3 cells was more than 50%, and had no significant effect on RHOBTB3 mRNA in HO8910 cells and SKOV3 cells ( Figure 5 A-D).

[0055] Clonogenic experiment

[0056] After 24 hours of transfection, overexpressed or knocked down ovarian cancer cells were taken, and 2000 cells were planted in a 6-well plate with 2ml of medium in each well. Culture at 37°C in an incubator...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of hsa_circ_0007444 in preparation of a medicine for treating ovarian cancer. According to the research, a hsa_circ_0007444 overexpression plasmid vector is prepared, and the function of the hsa_circ_0007444 overexpression plasmid vector in ovarian cancer cells is verified by overexpression lentivirus and specific siRNA. The overexpression hsa_circ_0007444 can obviously inhibit proliferation, invasion and migration of ovarian cancer and promote apoptosis of ovarian cancer, and knockdown of hsa_circ_0007444 can obviously promote proliferation, invasion and migration of ovarian cancer and inhibit apoptosis of ovarian cancer. Meanwhile, hsa_circ_0007444 overexpression can inhibit growth and lung metastasis of ovarian cancer in vivo and is an important target for treating ovarian cancer.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals and relates to the application of hsa_circ_0007444 in the preparation of drugs for treating ovarian cancer. Background technique [0002] Ovarian cancer is the gynecological malignancy with the highest mortality rate, which seriously threatens women's life and health. Cytoreductive surgery combined with platinum-based chemotherapy is the main clinical treatment. With the improvement of surgical skills and chemotherapy, the short-term survival rate of ovarian cancer patients has increased significantly. However, the long-term recurrence rate is high and the prognosis is still poor. . Ovarian cancer's extremely high metastatic ability and recurrence caused by extensive metastases are one of the main causes of death in patients [1]. Therefore, in-depth exploration of the mechanism of ovarian cancer progression and metastasis is still the top priority of ovarian cancer research. [0003] In recent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61P35/00A61P35/04
CPCA61K45/00A61P35/00A61P35/04
Inventor 贾雪梅沈嵘徐娟滕芳张敏李大可从雨
Owner NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com