Application of hsa_circ_0007444 in preparation of medicine for treating ovarian cancer
A kind of ovarian cancer, ovarian epithelial cancer technology, applied in the application field of medicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] RNA extraction, PCR and sanger sequencing
[0033] The total RNA of the cells was extracted according to the Trizol extraction instructions, and about 3000ngRNA was incubated with 3U / 1000ng RNaseR and 1U / 1000ng DNase I at 37°C for 15 minutes, and then the RNA was purified with the RNeasy MinEluteCleanup Kit from QIAGEN, according to the reverse reaction of Thermo Fisher. The instructions for the transcription kit reverse transcribe the RNA into cDNA. Use the primers located at the interface to amplify the full-length has_circ_0007444 (circ_0007444-jF: ATTCAGGTGCTTTTCAGTGGGA (SEQ ID NO.1), has_circ_0007444-jR: CGCTTCAGCCTTTAAGACAGG (SEQ ID NO.2)) for PCR amplification, and then send it to GenScript The company performs Sanger sequencing.
[0034] circRNA localization analysis
[0035] The RNA in the nucleus and cytoplasm of ovarian cancer cells was extracted using Invitrogen's PARIS KIT, and the RNA was reverse-transcribed into cDNA according to the instructions of the...
Embodiment 2
[0038] cell culture
[0039] The ovarian cancer cell line SKOV3 was purchased from the Cell Bank of Shanghai Chinese Academy of Sciences, and A2780 cells and HO8910 cells were purchased from Jiangsu KGI Biotechnology Co., Ltd. SKOV3 cells were cultured in McCoy's 5A+10% FBS+1% double antibody, A2780 cells and HO8910 cells were cultured in DMEM+10% FBS+1% double antibody. The culture condition is 5% CO 2 , 37°C.
[0040] Vector construction and cell transfection
[0041] Design and synthesize has_circ_0007444 full-length primers, primer sequences: has_circ_0007444-qF:TTCTCTGCGCTGTAAGCCATGT (SEQ ID NO.9), has_circ_0007444-qR:AACGATCTTGTGGGCCTCTACA (SEQ ID NO.10), using the cDNA of SKOV3 cells as a template, PCR amplification products, respectively Cloned to the overexpression lentiviral vector GPLVX-Mini-GFP-Puro after EcoRI and BamHI double digestion (see the plasmid spectrum figure 1 ), carry out agarose gel electrophoresis on the digested product, after the electrophoresi...
Embodiment 3
[0053] siRNA synthesis and transfection
[0054] The siRNAs were synthesized by Guangzhou Ruibo Biotech Co., Ltd., and the sequences were si-h-has-circ-0007444-si1:ACACCAGGAAAGAAAAAAT (SEQ ID NO.17), si-h-has-circ-0007444-si2:CCAGGAAAGAAAAAATGCC (SEQ ID NO.18), si-h-has-circ-0007444-si3: AAAGAAAAAATGCCTGTCT (SEQ ID NO.19). Transfection was performed according to the instruction manual of lipo2000, and the knockdown efficiency was detected by qRT-PCR. .Transient has_circ_0007444 specific siRNA, qRT-PCR results showed that the knockdown efficiency of siRNA-1 and siRNA-2 on has_circ_0007444 in HO8910 cells and SKOV3 cells was more than 50%, and had no significant effect on RHOBTB3 mRNA in HO8910 cells and SKOV3 cells ( Figure 5 A-D).
[0055] Clonogenic experiment
[0056] After 24 hours of transfection, overexpressed or knocked down ovarian cancer cells were taken, and 2000 cells were planted in a 6-well plate with 2ml of medium in each well. Culture at 37°C in an incubator...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com