Method, construction and application for inhibiting cell aggregation of Pichia kurdori strain

A technology for inhibiting cells and yeast strains, applied in the field of yeast, can solve problems such as unfavorable oxygen and nutrient transfer, affect the production performance of strains, etc., achieve the effect of increasing biomass, facilitating the transfer of nutrients and oxygen, and improving production performance

Active Publication Date: 2021-11-23
WENZHOU UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Pichia kudriavzevii grows in the form of pseudohyphae and aggregates with each other under acidic conditions with pH less than 2.5 (such as figure 1 shown), this phenomenon is not conducive to the transfer of oxygen and nutrients, which seriously affects the production performance of the strain during low pH fermentation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, construction and application for inhibiting cell aggregation of Pichia kurdori strain
  • Method, construction and application for inhibiting cell aggregation of Pichia kurdori strain
  • Method, construction and application for inhibiting cell aggregation of Pichia kurdori strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: A method for inhibiting cell aggregation of Pichia kurdori strains, preparing 200mM arginine mother liquor, filtering and sterilizing for later use; the Pichia kurdori growth YPD medium includes the following mass concentration components: glucose 20g / L, peptone 20g / L and yeast extract 10g / L; then use HCl or NaOH to adjust the pH of the YPD medium, and add 5mmol / L arginine to it after autoclaving, such as figure 2 As shown, arginine was exogenously added to YPD medium under different pH conditions. The results showed that the addition of 5mmol / L arginine could significantly promote the growth of Pichia pichia under low pH pressure. At the same time, the pHi was significantly increased in the presence of arginine, indicating that arginine played a positive role in protecting Pichia kudori against low pH stress, and the cell aggregation effect was significantly reduced when arginine was added.

Embodiment 2

[0021] Embodiment 2:: the construction method of the recombinant Pichia kudriavzevii that inhibits cell aggregation, in the Pichia kudriavzevii N-X in the Pichia kudriavzevii strain, obtain the recombinant strain that overexpresses the ARG J gene; Wherein, Pichiakudriavzevii N-X is preserved in China Type Culture Collection Center (CCTCC); address: Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, preservation number: CCTCC M 2017759, gene accession number MT499446 of the ARG J gene; specifically includes the following steps:

[0022] a, using primers Pdc1F, Pdc1R and Pichia kurdori N-X genomic DNA as template amplification to obtain a fragment containing the PDC1 gene promoter, reading frame and terminator, and connecting it into the pMD19T vector; the primer Pdc1F is CGCGGATCCGCGTTTAAGTGGTGGTTGTA, the Primer Pdc1R is CGG GGTACCTGGT GAGATTGATGGATTGT;

[0023] b. Reverse amplification using primers 0-F and 0-R; the primer 0-F is ACAGATAAGTACCTAGGGAGATT,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method, construction and application for inhibiting cell aggregation of Pichia kudori strains. Adding arginine can significantly promote the growth of Pichia kudori under extremely acidic conditions, relieve cell aggregation, and benefit oxygen and The delivery of nutrients improves the production performance of the strains during low pH fermentation. The present invention also constructs a Pichia pastoris that inhibits cell aggregation. The Pichia pastoris is a recombinant strain that overexpresses ARGJ, and the intracellular arginine content is increased by 26.3%. The amount has been significantly increased, and the cell aggregation effect has been significantly alleviated, which is conducive to the transfer of nutrients and oxygen.

Description

technical field [0001] The invention relates to the field of yeast technology, in particular to a method, construction and application for inhibiting cell aggregation of Pichia kudori strains. Background technique [0002] When organic acids are produced by fermentation, with the accumulation of products, organic acids enter microbial cells by simple diffusion and dissociate into charged acid radical ions and protons, resulting in a decrease in intracellular pH (pHi), affecting the conformation and The progress of the intracellular enzymatic reaction will also interfere with the active transmembrane transport driven by protons, affect the absorption of nutrients by microbial cells, and lead to a sharp decline in fermentation performance. The development of low-pH fermentation technology that relies on acid-tolerant hosts can significantly reduce or even eliminate the use of neutralizers, simplify the production process, reduce the risk of bacterial contamination, and save en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/16C12N1/38C12N1/19C12R1/84
CPCC07K14/39C12N1/16C12N1/38
Inventor 嵇豪金立波孙达彭仁义林苏娥董夏梦
Owner WENZHOU UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap