Method, construction and application for inhibiting cell aggregation of Pichia kurdori strain
A technology for inhibiting cells and yeast strains, applied in the field of yeast, can solve problems such as unfavorable oxygen and nutrient transfer, affect the production performance of strains, etc., achieve the effect of increasing biomass, facilitating the transfer of nutrients and oxygen, and improving production performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1: A method for inhibiting cell aggregation of Pichia kurdori strains, preparing 200mM arginine mother liquor, filtering and sterilizing for later use; the Pichia kurdori growth YPD medium includes the following mass concentration components: glucose 20g / L, peptone 20g / L and yeast extract 10g / L; then use HCl or NaOH to adjust the pH of the YPD medium, and add 5mmol / L arginine to it after autoclaving, such as figure 2 As shown, arginine was exogenously added to YPD medium under different pH conditions. The results showed that the addition of 5mmol / L arginine could significantly promote the growth of Pichia pichia under low pH pressure. At the same time, the pHi was significantly increased in the presence of arginine, indicating that arginine played a positive role in protecting Pichia kudori against low pH stress, and the cell aggregation effect was significantly reduced when arginine was added.
Embodiment 2
[0021] Embodiment 2:: the construction method of the recombinant Pichia kudriavzevii that inhibits cell aggregation, in the Pichia kudriavzevii N-X in the Pichia kudriavzevii strain, obtain the recombinant strain that overexpresses the ARG J gene; Wherein, Pichiakudriavzevii N-X is preserved in China Type Culture Collection Center (CCTCC); address: Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, preservation number: CCTCC M 2017759, gene accession number MT499446 of the ARG J gene; specifically includes the following steps:
[0022] a, using primers Pdc1F, Pdc1R and Pichia kurdori N-X genomic DNA as template amplification to obtain a fragment containing the PDC1 gene promoter, reading frame and terminator, and connecting it into the pMD19T vector; the primer Pdc1F is CGCGGATCCGCGTTTAAGTGGTGGTTGTA, the Primer Pdc1R is CGG GGTACCTGGT GAGATTGATGGATTGT;
[0023] b. Reverse amplification using primers 0-F and 0-R; the primer 0-F is ACAGATAAGTACCTAGGGAGATT,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


