Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chromatin remodeling factor btbrm2 of whitefly med cryptic species and its encoding gene and application

A Bemisia tabaci, chromatin technology, applied in the field of agricultural biology, can solve problems such as unknown effects

Active Publication Date: 2022-03-25
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its role in temperature stress in Bemisia tabaci remains unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chromatin remodeling factor btbrm2 of whitefly med cryptic species and its encoding gene and application
  • Chromatin remodeling factor btbrm2 of whitefly med cryptic species and its encoding gene and application
  • Chromatin remodeling factor btbrm2 of whitefly med cryptic species and its encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Cloning of full-length cDNA sequence of Btbrm2 gene of Bemisia tabaci MED cryptic species

[0024] Take 200 adults of Bemisia tabaci under different temperature stress conditions and put them into 1.5mL centrifuge tubes, freeze them in liquid nitrogen, grind them into powder with a grinding rod, then extract RNA, and store them at -80°C for later use. The extracted RNA was reverse-transcribed to synthesize cDNA according to the instruction of One-Step gDNA Removal and cDNA Synthesis SuperMix. Using cDNA as a template, primers were designed for PCR amplification. The designed primers are shown in Table 1 and Table 2:

[0025] Table 1

[0026]

[0027] Table 2

[0028]

[0029] The experiment found that the full-length cDNA of Btbrm2 gene of Bemisia tabaci MED cryptic species was obtained by PCR amplification using the primers in Table 1. However, the target gene sequence could not be obtained using the primers in Table 2.

[0030] Using the sequence...

Embodiment 2

[0031] Example 2: Analysis of the expression characteristics of the Btbrm2 gene

[0032] (1) Extracting RNA and synthesizing cDNA from adult Bemisia tabaci under different temperature stresses

[0033] Adults of B. tabaci cryptic species MED and Asia II 1 cryptic species that had just emerged were selected, and adults of B. tabaci were subjected to stress treatment at 0, 12, 26, 35, and 40°C, respectively. Three biological replicates each, with a total of 3000 adults, were placed in liquid nitrogen for 3 minutes immediately after the end of the stress and stored at -80°C. According to the method of Example 1, RNA was extracted and reverse transcribed into cDNA.

[0034] (2) Real-time quantitative PCR detection of Btbrm2 expression at different temperatures:

[0035] Design primers for the Btbrm2 gene and two internal reference genes (EF1-α, β-tublin) for fluorescent quantitative PCR:

[0036] brm2-QF:AAAACCATCCAAACAATCGC

[0037] brm2-QR: TTTCAAACTCCAACACCCAA

[0038] EF1...

Embodiment 3

[0047] Example 3: Analysis of the influence of Btbrm2 gene on the temperature tolerance of Bemisia tabaci MED cryptic species

[0048] 3.1 Synthesis of dsRNA

[0049] (1) Design and synthesize the primer sequence plus the T7 promoter (sequence shown underlined):

[0050] T7+Btbrm2-F: 5'- TAATACGACTCACTATAGGG TGTGATATGTCAGGGCT-3'

[0051] T7+Btbrm2-R: 5'- TAATACGACTCACTATAGGG TACTCGGTGATTGGTGG-3'. Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0052] (2) Extraction of total RNA and synthesis of cDNA: same as in Example 1.

[0053] (3) T7 primer PCR amplification and product purification, the purified PCR product is the template for synthesizing dsRNA. Use the kit to synthesize and purify dsRNA, and operate according to the kit instructions.

[0054] 3.2 dsRNA Feeding

[0055] Parafilm membranes were pre-treated with DEPC water to remove RNases. The dsRNA was added to the 10% sucrose solution at a concentration of 0.3-0.5 μg / μL. Accordin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of agricultural biotechnology, in particular to the chromatin remodeling factor Btbrm2 of the Bemisia tabaci MED cryptic species and its coding gene and application. The amino acid sequence of the remodeling factor is shown in SEQ ID No:2. The present invention clarifies the differences in the expression patterns of the Btbrm2 gene between the invasive species MED cryptic species of Bemisia tabaci and the local species Asia II 1 cryptic species at different temperatures. Decreasing the expression of this gene directly reduced the tolerance of MED cryptic species to adversity temperature. The obtained results lay the foundation for further research on the relationship between the temperature tolerance mechanism of Bemisia tabaci MED cryptic species and epigenetic chromatin remodeling, which can be used to destroy the temperature tolerance of Bemisia tabaci, and then be used to control tobacco powder Danger and spread of lice.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to the chromatin remodeling factor Btbrm2 of the Bemisia tabaci MED cryptic species and its coding gene and application. Background technique [0002] Bemisia tabaci (Gennadius) belongs to the phylum Arthropoda, class Insecta, order Hemiptera, family Amisidae, genus Amisia, and is an important agricultural pest worldwide. The host range of this insect is very wide, and it can harm more than 600 species of legumes, Solanaceae, Compositae, Cucurbitaceae, Malvaceae and Brassicaceae by feeding on plant juice, secreting honeydew to induce soot, and spreading plant viruses. It is a major pest that must be dealt with in crop production in our country. Bemisia tabaci is a species complex containing more than 36 cryptic species. At present, there are 15 cryptic species of Bemisia tabaci in my country, including 2 invasive species and 13 native species. The invasive species MED cr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12A01N57/16A01P7/04
CPCC07K14/43563A01N57/16Y02A90/40
Inventor 吕志创冀顺霞王晓迪申晓娜刘万学万方浩
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products