Chromatin remodeling factor btbrm2 of whitefly med cryptic species and its encoding gene and application
A Bemisia tabaci, chromatin technology, applied in the field of agricultural biology, can solve problems such as unknown effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Cloning of full-length cDNA sequence of Btbrm2 gene of Bemisia tabaci MED cryptic species
[0024] Take 200 adults of Bemisia tabaci under different temperature stress conditions and put them into 1.5mL centrifuge tubes, freeze them in liquid nitrogen, grind them into powder with a grinding rod, then extract RNA, and store them at -80°C for later use. The extracted RNA was reverse-transcribed to synthesize cDNA according to the instruction of One-Step gDNA Removal and cDNA Synthesis SuperMix. Using cDNA as a template, primers were designed for PCR amplification. The designed primers are shown in Table 1 and Table 2:
[0025] Table 1
[0026]
[0027] Table 2
[0028]
[0029] The experiment found that the full-length cDNA of Btbrm2 gene of Bemisia tabaci MED cryptic species was obtained by PCR amplification using the primers in Table 1. However, the target gene sequence could not be obtained using the primers in Table 2.
[0030] Using the sequence...
Embodiment 2
[0031] Example 2: Analysis of the expression characteristics of the Btbrm2 gene
[0032] (1) Extracting RNA and synthesizing cDNA from adult Bemisia tabaci under different temperature stresses
[0033] Adults of B. tabaci cryptic species MED and Asia II 1 cryptic species that had just emerged were selected, and adults of B. tabaci were subjected to stress treatment at 0, 12, 26, 35, and 40°C, respectively. Three biological replicates each, with a total of 3000 adults, were placed in liquid nitrogen for 3 minutes immediately after the end of the stress and stored at -80°C. According to the method of Example 1, RNA was extracted and reverse transcribed into cDNA.
[0034] (2) Real-time quantitative PCR detection of Btbrm2 expression at different temperatures:
[0035] Design primers for the Btbrm2 gene and two internal reference genes (EF1-α, β-tublin) for fluorescent quantitative PCR:
[0036] brm2-QF:AAAACCATCCAAACAATCGC
[0037] brm2-QR: TTTCAAACTCCAACACCCAA
[0038] EF1...
Embodiment 3
[0047] Example 3: Analysis of the influence of Btbrm2 gene on the temperature tolerance of Bemisia tabaci MED cryptic species
[0048] 3.1 Synthesis of dsRNA
[0049] (1) Design and synthesize the primer sequence plus the T7 promoter (sequence shown underlined):
[0050] T7+Btbrm2-F: 5'- TAATACGACTCACTATAGGG TGTGATATGTCAGGGCT-3'
[0051] T7+Btbrm2-R: 5'- TAATACGACTCACTATAGGG TACTCGGTGATTGGTGG-3'. Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0052] (2) Extraction of total RNA and synthesis of cDNA: same as in Example 1.
[0053] (3) T7 primer PCR amplification and product purification, the purified PCR product is the template for synthesizing dsRNA. Use the kit to synthesize and purify dsRNA, and operate according to the kit instructions.
[0054] 3.2 dsRNA Feeding
[0055] Parafilm membranes were pre-treated with DEPC water to remove RNases. The dsRNA was added to the 10% sucrose solution at a concentration of 0.3-0.5 μg / μL. Accordin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


