Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chromatin remodeling factor ISWI, coding gene and effect in temperature tolerance of bemisia tabaci MED cryptic species

A technology of Bemisia tabaci and chromatin, applied in the field of agricultural biology, can solve problems such as unknown functions

Active Publication Date: 2020-10-13
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its role in temperature stress in Bemisia tabaci remains unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chromatin remodeling factor ISWI, coding gene and effect in temperature tolerance of bemisia tabaci MED cryptic species
  • Chromatin remodeling factor ISWI, coding gene and effect in temperature tolerance of bemisia tabaci MED cryptic species
  • Chromatin remodeling factor ISWI, coding gene and effect in temperature tolerance of bemisia tabaci MED cryptic species

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Cloning of full-length cDNA sequence of Btiswi gene of Bemisia tabaci MED cryptic species

[0024] Take 200 adults of Bemisia tabaci under different temperature stress conditions and put them into 1.5mL centrifuge tubes, freeze them in liquid nitrogen, grind them into powder with a grinding rod, then extract RNA, and store them at -80°C for later use. The extracted RNA was reverse-transcribed to synthesize cDNA according to the instructions of the All-Gold Reverse Transcription Kit (One-Step gDNA Removal and cDNA Synthesis SuperMix). Using cDNA as a template, primers were designed for PCR amplification. The designed primers are shown in Table 1.

[0025] Table 1

[0026]

[0027] Utilize table 1 sequence, through PCR amplification, obtain the cDNA sequence full-length of Btiswi gene and be 3069bp, the gene of gain has the nucleotide sequence shown in SEQ ID No:1, this gene encodes 1022 such as SEQ ID No:2 Amino acid sequence shown. Using the online dat...

Embodiment 2

[0028] Embodiment 2: Analysis of the expression characteristics of Btiswi gene

[0029] (1) Extracting RNA and synthesizing cDNA from adult Bemisia tabaci under different temperature stresses

[0030] The newly emerged adults of the cryptic species of Bemisia tabaci were selected, and the adults of Bemisia tabaci were subjected to stress treatment at 0, 12, 26, 35, and 40°C, respectively. Three biological replicates each, with a total of 3000 adults, were placed in liquid nitrogen for 3 minutes immediately after the end of the stress and stored at -80°C. According to the method of Example 1, RNA was extracted and reverse transcribed into cDNA.

[0031] (2) Real-time quantitative PCR detection of Btiswi expression at different temperatures:

[0032] Design primers for the Btiswi gene and two internal reference genes (EF1-α, β-tublin) for fluorescent quantitative PCR:

[0033] iswi-QF:GCAGGTTAGATGGTCAAACTCCCC

[0034] iswi-QR:TTTTCCTCAACAGTATTTTCGGTG

[0035] EF1-α-F: TAGCC...

Embodiment 3

[0044] Example 3: Analysis of the influence of Btiswi gene on the temperature tolerance of Bemisia tabaci MED cryptic species

[0045] 3.1 Synthesis of dsRNA

[0046] (1) Design and synthesize the primer sequence plus the T7 promoter (sequence shown underlined):

[0047] T7+Btiswi-F: 5'- TAATACGACTCACTATAGGG CTCCGATTCACCCTCT-3'

[0048] T7+Btiswi-R: 5'- TAATACGACTCACTATAGGG GTCCCAGTCTCCAGGC-3'. Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0049] (2) Extraction of total RNA and synthesis of cDNA: same as in Example 1.

[0050] (3) T7 primer PCR amplification and product purification, the purified PCR product is the template for synthesizing dsRNA. Use the kit to synthesize and purify dsRNA, and operate according to the kit instructions.

[0051] 3.2 dsRNA Feeding

[0052] Parafilm membranes were pre-treated with DEPC water to remove RNases. The dsRNA was added to the 10% sucrose solution at a concentration of 0.3-0.5 μg / μL. According ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic species chromatin remodeling gene Btiswi and application thereof. The nucleotide sequence of the gene is shown as SEQ ID No: 1. The expression mode of the Btiswi gene in bemisia tabaci MED cryptic species under the temperature gradient is defined. The tolerance capacity of the MED cryptic species to the stress temperature is directly reduced by reducing expression of the gene. The obtained result lays a foundation for further defining the effect of the chromatin remodeling factorin the process that bemisia tabaci rapidly adapts to the poor environment condition, and a theoretical basis is provided for further revealing rapid expansion and outbreak disaster-forming mechanismof the MED cryptic species. The bemisia tabaci MED cryptic species chromatin remodeling gene Btiswi can be used for damaging the temperature tolerance of the bemisia tabaci and then used for preventing and controlling harm and diffusion of the bemisia tabaci.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to the chromatin remodeling factor ISWI, the coding gene and its role in the temperature tolerance of the Bemisia tabaci MED cryptic species. Background technique [0002] Bemisia tabaci (Gennadius) belongs to the phylum Arthropoda, class Insecta, order Hemiptera, family Amisidae, genus Amisia, and is an important agricultural pest worldwide. The host range of this insect is very wide, and it can harm more than 600 species of legumes, Solanaceae, Compositae, Cucurbitaceae, Malvaceae and Brassicaceae by feeding on plant juice, secreting honeydew to induce soot, and spreading plant viruses. It is a major pest that must be dealt with in crop production in our country. [0003] With the change of global temperature, the successful adaptation of Bemisia tabaci MED cryptic species in different geographical environments has widely aroused the theoretical discussion of its invasio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12A01N57/16A01P7/04
CPCA01N57/16C07K14/43563
Inventor 吕志创冀顺霞王晓迪申晓娜刘万学万方浩
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com