Chromatin remodeling factor ISWI, coding gene and effect in temperature tolerance of bemisia tabaci MED cryptic species
A technology of Bemisia tabaci and chromatin, applied in the field of agricultural biology, can solve problems such as unknown functions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Cloning of full-length cDNA sequence of Btiswi gene of Bemisia tabaci MED cryptic species
[0024] Take 200 adults of Bemisia tabaci under different temperature stress conditions and put them into 1.5mL centrifuge tubes, freeze them in liquid nitrogen, grind them into powder with a grinding rod, then extract RNA, and store them at -80°C for later use. The extracted RNA was reverse-transcribed to synthesize cDNA according to the instructions of the All-Gold Reverse Transcription Kit (One-Step gDNA Removal and cDNA Synthesis SuperMix). Using cDNA as a template, primers were designed for PCR amplification. The designed primers are shown in Table 1.
[0025] Table 1
[0026]
[0027] Utilize table 1 sequence, through PCR amplification, obtain the cDNA sequence full-length of Btiswi gene and be 3069bp, the gene of gain has the nucleotide sequence shown in SEQ ID No:1, this gene encodes 1022 such as SEQ ID No:2 Amino acid sequence shown. Using the online dat...
Embodiment 2
[0028] Embodiment 2: Analysis of the expression characteristics of Btiswi gene
[0029] (1) Extracting RNA and synthesizing cDNA from adult Bemisia tabaci under different temperature stresses
[0030] The newly emerged adults of the cryptic species of Bemisia tabaci were selected, and the adults of Bemisia tabaci were subjected to stress treatment at 0, 12, 26, 35, and 40°C, respectively. Three biological replicates each, with a total of 3000 adults, were placed in liquid nitrogen for 3 minutes immediately after the end of the stress and stored at -80°C. According to the method of Example 1, RNA was extracted and reverse transcribed into cDNA.
[0031] (2) Real-time quantitative PCR detection of Btiswi expression at different temperatures:
[0032] Design primers for the Btiswi gene and two internal reference genes (EF1-α, β-tublin) for fluorescent quantitative PCR:
[0033] iswi-QF:GCAGGTTAGATGGTCAAACTCCCC
[0034] iswi-QR:TTTTCCTCAACAGTATTTTCGGTG
[0035] EF1-α-F: TAGCC...
Embodiment 3
[0044] Example 3: Analysis of the influence of Btiswi gene on the temperature tolerance of Bemisia tabaci MED cryptic species
[0045] 3.1 Synthesis of dsRNA
[0046] (1) Design and synthesize the primer sequence plus the T7 promoter (sequence shown underlined):
[0047] T7+Btiswi-F: 5'- TAATACGACTCACTATAGGG CTCCGATTCACCCTCT-3'
[0048] T7+Btiswi-R: 5'- TAATACGACTCACTATAGGG GTCCCAGTCTCCAGGC-3'. Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0049] (2) Extraction of total RNA and synthesis of cDNA: same as in Example 1.
[0050] (3) T7 primer PCR amplification and product purification, the purified PCR product is the template for synthesizing dsRNA. Use the kit to synthesize and purify dsRNA, and operate according to the kit instructions.
[0051] 3.2 dsRNA Feeding
[0052] Parafilm membranes were pre-treated with DEPC water to remove RNases. The dsRNA was added to the 10% sucrose solution at a concentration of 0.3-0.5 μg / μL. According ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



