Bemisia tabaci MED cryptic species chromatin remodeling factor Btbrm2 as well as encoding gene and application thereof

A technology of Bemisia tabaci and chromatin, applied in the field of agricultural biology, can solve problems such as unknown functions

Active Publication Date: 2020-10-13
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its role in temperature ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bemisia tabaci MED cryptic species chromatin remodeling factor Btbrm2 as well as encoding gene and application thereof
  • Bemisia tabaci MED cryptic species chromatin remodeling factor Btbrm2 as well as encoding gene and application thereof
  • Bemisia tabaci MED cryptic species chromatin remodeling factor Btbrm2 as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Cloning of full-length cDNA sequence of Bemisia tabaci MED hidden Btbrm2 gene

[0025] Take 200 Bemisia tabaci adults under different temperature stress conditions and put them into a 1.5mL centrifuge tube. After freezing in liquid nitrogen, they are ground into powder with a grinding rod, and then RNA is extracted and stored at -80°C for later use. According to the instructions of the One-Step gDNA Removal and cDNA Synthesis SuperMix, the extracted RNA was reverse transcribed to synthesize cDNA. Using cDNA as a template, design primers for PCR amplification. The designed primers are shown in Table 1 and Table 2:

[0026] Table 1

[0027]

[0028] Table 2

[0029]

[0030] The experiment found that, using the primers in Table 1, PCR amplification was used to obtain the full-length cDNA of the Bemisia tabaci MED cryptic Btbrm2 gene. Using the primers in Table 2, the target gene sequence cannot be obtained.

[0031] Using the sequence in Table 1, amplified by PCR, th...

Embodiment 2

[0032] Example 2: Analysis of the expression characteristics of Btbrm2 gene

[0033] (1) Extract RNA and synthesize cDNA from adults of Bemisia tabaci under different temperature stress

[0034] The newly emerging Bemisia tabaci MED cryptic species and Asia II 1 cryptic species adults were selected, and the Bemisia tabaci adults were subjected to stress treatments at 0, 12, 26, 35, and 40 ℃, respectively. Three biological replicates each, a total of 3000 adults, immediately placed in liquid nitrogen after the end of the stress, frozen for 3 minutes and then stored at -80 ℃. According to the method of Example 1, RNA was extracted and reverse transcribed into cDNA.

[0035] (2) Fluorescence quantitative PCR to detect the expression of Btbrm2 at different temperatures:

[0036] Design primers for the Btbrm2 gene and two internal reference genes (EF1-α, β-tublin) for fluorescent quantitative PCR:

[0037] brm2-QF: AAAACCATCCAAACAATCGC

[0038] brm2-QR: TTTCAAACTCCAACACCCAA

[0039] EF1-α-F:...

Embodiment 3

[0048] Example 3: Analysis of the effect of Btbrm2 gene on temperature tolerance of Bemisia tabaci MED cryptic species

[0049] 3.1 Synthesis of dsRNA

[0050] (1) Design and synthesize the primer sequence with T7 promoter (sequence shown underline):

[0051] T7+Btbrm2-F: 5’- TAATACGACTCACTATAGGG TGTGATATGTCAGGGCT-3’

[0052] T7+Btbrm2-R: 5’- TAATACGACTCACTATAGGG TACTCGGTGATTGGTGG-3’. Synthesized by Shanghai Shenggong Biological Engineering Technology Service Co., Ltd.

[0053] (2) Total RNA extraction and cDNA synthesis: same as in Example 1.

[0054] (3) T7 primer PCR amplification and product purification, the purified PCR product is the template for dsRNA synthesis. Use the kit to synthesize and purify dsRNA, and follow the kit instructions.

[0055] 3.2 dsRNA feeding

[0056] Parafilm membranes were pre-treated with DEPC water to remove RNase. Add dsRNA to the 10% sucrose solution at a concentration of 0.3-0.5μg / μL. According to the feeding characteristics of Bemisia tabaci, t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic species chromatin remodeling factor Btbrm2 and an encoding gene and application thereof. The amino acid sequence of the remodeling factor is shown as SEQ ID No: 2. According to the invention, the difference of expression modes of the Btbrm2 gene in a bemisia tabaci invasive species MED cryptic species and a local species Asia II1 cryptic species at different temperatures is defined. Reducing the expression of this gene directly reduces the tolerance of MED cryptic species to stress temperatures. The obtained result lays a foundation for further researching the relationship between the temperature tolerance mechanism of the bemisia tabaci MED cryptic species and epigenetic chromatin remodeling, and can be used for destroying the temperature tolerance of the bemisia tabaci and further preventing and treating the harm and diffusion of the bemisia tabaci.

Description

Technical field [0001] The present invention relates to the field of agricultural biotechnology, in particular to the Bemisia tabaci MED cryptic chromatin remodeling factor Btbrm2 and its coding gene and application. Background technique [0002] Bemisia tabaci (Gennadius) belongs to the phylum Arthropod, Insecta, Hemiptera, Whitefly family, and small whitefly, and is an important agricultural pest worldwide. The host range of this insect is very wide, and it can harm legumes, Solanaceae, Compositae, Cucurbitaceae, Malvaceae, Cruciferae, etc. by feeding on plant juices, secreting honeydew to induce coal pollution, and spreading plant viruses. Growing cash crops is a major pest that my country's crop production must deal with. Bemisia tabaci is a species complex containing more than 36 cryptic species. There are currently 15 hidden species of Bemisia tabaci in my country, including 2 invasive species and 13 native species. The invasive species of MED is widely distributed throug...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/435C12N15/12A01N57/16A01P7/04
CPCC07K14/43563A01N57/16Y02A90/40
Inventor 吕志创冀顺霞王晓迪申晓娜刘万学万方浩
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap