Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method and kit for constructing universal genetic testing library for Alport syndrome

A technology of gene detection and library construction, applied in the field of gene detection, can solve the problems of clinical application limitations, sequencing data generation, uncommon libraries, etc., to avoid false positives, realize authenticity interpretation, and overcome the effect of label jumping

Active Publication Date: 2020-10-16
ANNGEEN BIOTECHNOLOGY CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the NGS sequencing platforms widely used in clinical practice are mainly IonTorrent and Illumina. However, due to the different principles of sequencing technology, different platforms adopt different technical procedures for library construction, which makes the library not universal, that is, the library suitable for the Ion Torrent platform cannot be used on the Illumina platform. Generate sequencing data and vice versa
This has greatly limited clinical applications, so it is necessary to find a universal gene detection library for Alport syndrome that is suitable for different sequencing platforms and adapts to different clinical needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for constructing universal genetic testing library for Alport syndrome
  • Method and kit for constructing universal genetic testing library for Alport syndrome
  • Method and kit for constructing universal genetic testing library for Alport syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Design and preparation of universal high-throughput sequencing adapters

[0059] Based on the applicant's previous patent application CN202010407833.5, a universal sequencing linker sequence that can be used for genes such as COL4A3, COL4A4, COL4A5, COL4A6, and MYH9, and is also applicable to Ion Torrent and Illumina multi-sequencing platforms was designed and prepared. The specific method is as follows:

[0060] according to figure 1 The composition of the linker assembly shown is to design 10 sets of universal high-throughput sequencing linker AN1 / PN1-AN10 / PN10 for the full coding region and variable splicing region of COL4A3, COL4A4, COL4A5, COL4A6 and MYH9 genes, which have:

[0061] First synthesize the following single strand

[0062] sequence a:

[0063] 5'-XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCCGT-3';

[0064] Sequence b:

[0065] 5'-GAACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3...

Embodiment 2

[0079] Example 2 Construction of a universal gene detection library for Alport syndrome

[0080] Collect 10 samples from patients with Alport syndrome in Peking Union Medical College Hospital for library construction, using the full coding region and variable splicing region (20bp extension from exon to intron) of COL4A3, COL4A4, COL4A5, COL4A6 and MYH9 genes As the primer pool of the target region, perform multiple reaction PCR, and connect the sequencing adapter to construct the library. The specific operation process is as follows:

[0081] (1) Nucleic acid extraction and quality inspection: after blood cells undergo nucleic acid extraction and quality inspection, they are required to meet certain quality control standards: DNA concentration: 10ng / μL; DNA purity: OD260 / 280 1.8-2.0, OD260 / 230>2; DNA Total starting amount: 20ng.

[0082] (2) Multiplex PCR primer design and amplification:

[0083] Design a primer pool based on the full coding region of COL4A3, COL4A4, COL4A5...

Embodiment 3

[0091] Example 3 Multi-platform sequencing verification and detection

[0092] Combined with the high-throughput sequencing platform Ion GeneStudio TM The S5 Plus platform and the Miseq DX platform perform DNA sequencing, and then detect point mutations (SNP) and small fragment insertion-deletion (InDel). The specific steps are as follows:

[0093] (1) After purification, the library was quality checked and quantified using Agilent 2100 and QUBIT 4.0. Library 2100 quality control map see Figure 2-3 , showing that the main peak of the library length fragment is around 400bp and the main peak of the library is a single sharp single peak. The results indicate that the two ends of the target gene fragment have been connected with universal high-throughput sequencing adapters. The library concentration was calculated according to the dilution factor. If the library concentration is higher than 1ng / uL, the subsequent experimental steps can be performed, and if the library concent...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method and kit for constructing a universal genetic testing library for an Alport syndrome. The construction method and kit provided by the invention relate to gene mutationof COL4A3, COL4A4, COL4A5, COL4A6 and MYH9, can be compatible with multiple sequencing platforms, including an Ion Torrent platform, an Illumina platform and other platforms and have multiple advantages that the library construction steps are simple and fast, the cost is reduced and the application range is wide.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to a method and kit for constructing a universal gene detection library for Alport syndrome. Background technique [0002] Alport syndrome, also known as hereditary progressive nephritis, is one of the most common hereditary kidney diseases, with an incidence of about 1 / 5000. The main clinical manifestations of Alport syndrome are hematuria, proteinuria and progressive renal dysfunction. Hematuria is the most common clinical manifestation in patients with Alport syndrome. Sexual hereditary patients have microscopic hematuria. Proteinuria does not appear in children or in the early stage of the disease or is very small, but it appears with age, and even develops to massive proteinuria. The renal prognosis of male patients with X-linked genetic Alport syndrome is extremely poor, and almost all develop to end-stage renal disease (ESRD). Usually, it takes 5-10 years from the beginning of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6869C12Q1/6806C40B50/06C40B40/08C12N15/11
CPCC12Q1/6806C12Q1/6869C12Q1/6883C12Q2600/16C40B40/08C40B50/06C12Q2525/191C12Q2531/113C12Q2537/143C12Q2535/122
Inventor 李亚峰李荣山辛晓红杨颖曹彦东扶媛媛
Owner ANNGEEN BIOTECHNOLOGY CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More