A kind of ospeamt2 gene, its protein and its application to improve the rice seed-setting rate at heading stage under high temperature stress

A technology of high temperature stress and heading time, applied in the field of genetic engineering, can solve the problems of lagging rice research and difficulties in high temperature research

Active Publication Date: 2022-05-10
SICHUAN AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the difficulty of high temperature research and environmental limitations, the research on high temperature in rice is still relatively lagging behind.
Although a large number of high-temperature-related genes have been reported in rice, there is still a big gap in how plants perceive high-temperature and conduct downstream signal transduction. Therefore, studying the functions of high-temperature-related genes, revealing the molecular mechanism, and mining and utilizing some excellent genes are of great help in ensuring high temperature. High and stable rice yield under stress has important practical significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of ospeamt2 gene, its protein and its application to improve the rice seed-setting rate at heading stage under high temperature stress
  • A kind of ospeamt2 gene, its protein and its application to improve the rice seed-setting rate at heading stage under high temperature stress
  • A kind of ospeamt2 gene, its protein and its application to improve the rice seed-setting rate at heading stage under high temperature stress

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Homologous Alignment Analysis of PEAMT Family Protein Sequences in Rice

[0027] 1. Homologous gene sequence acquisition

[0028] The protein sequence of rice is from the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu). The codes of the obtained protein sequences are as follows: OsPEAMT1 (LOC_Os01g50030), OsPEAMT2 (LOC_Os05g47540).

[0029] 2. Creation of evolutionary tree

[0030] Using DNAMAN7, the protein sequences of OsPEAMT1 and OsPEAMT2 were loaded into different lanes, and then the protein homology was analyzed by double-sequence alignment. The sequence analysis results are as figure 1 As shown, there are two PEAMT genes in rice, which are named OsPEAMT1 and OsPEAMT2 respectively. The data show that the homology of the two genes is as high as 86.46%. This application conducts research on OsPEAMT2, and explores the biological function of this type of gene in rice by designing a knockout experiment.

[0031] 3. Expression profiling ...

Embodiment 2

[0036] Example 2 OsPEAMT2 gene editing vector construction

[0037] 1. Gene editing site design

[0038] In this study, according to the existing CRISPR / Cas9-related experimental methods, ACTAATGTACCTTTCAGATGAGG, which contains AGG as the recognition site, was selected on the fifth exon of OsPEAMT2 as the knockout target site of OsPEAMT2 ( image 3 , Figure 4 ), it is expected to obtain a loss-of-function transgenic plant to clarify the biological function of the OsPEAMT2 gene.

[0039] 2. CRISPR / Cas9 vector construction

[0040] Take 5 μL of 10 μM primers before and after the target site, mix them, anneal at 99 °C for 5 min, and cool naturally to obtain a double-stranded sequence containing the knockout target site, then use Bas1 (NEB company) to digest and ligate (37 °C), and target site The dot sequence was connected to the intermediate vector pYLsgRNA-OsU6a, and then the universal amplification primers CTCCGTTTTACCTGTGGAATCG (UF) and CGGAGGAAAATTCCATCCAC (gR-R) were us...

Embodiment 3

[0047] Example 3 OsPEAMT2 gene editing under the background of Nihonbare

[0048] 1. Detection of transgenic seedlings

[0049] A total of 10 seedlings were obtained by Agrobacterium infection and transformation. First, the G418 detection primer was used to detect the transformation of the vector, and then the sequence in the positive individual plants was amplified with the amplification primers U1028 (TTCTGTAGAATGAGAACAT) + U1029 (ACTAGCTTCTCGACCTACAGTA) across the target site. Sent to Qingke Sequencing Company for sequencing, the results are as follows Figure 4 As shown, the comparison analysis of the obtained sequences showed that the transgenic plant ospeamt2, which was prematurely terminated in protein translation, was co-acquired.

[0050] 2. Phenotype Analysis

[0051] In the T1 generation planting, different lines were divided into 3 repeated plantings in field experiments, and 2 rows were planted for each repeated planting. First, the presence of stable mutations ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an OsPEAMT2 gene, its protein and application for improving the rice seed setting rate at the heading stage under high temperature stress. The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein is shown in SEQ ID NO.2. The invention provides a new high-temperature-related gene at the ear stage of rice, and provides a new gene resource for the improvement of rice yield traits and the breeding and utilization of rice temperature-sensitive sterile lines.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an OsPEAMT2 gene and its protein for improving the seed-setting rate of rice at the heading stage under high temperature stress and its application. Background technique [0002] In recent years, the trend of global warming has intensified and extreme high temperatures have occurred frequently, posing serious challenges to world food security (Pittelkow C M et al., 2015). As a high-temperature and short-day crop, rice is more vulnerable to high temperature stress during its growth. However, due to the difficulty of high temperature research and environmental limitations, research on high temperature in rice is still relatively lagging behind. Although a large number of high-temperature-related genes have been reported in rice, there is still a big gap in how plants perceive high-temperature and conduct downstream signal transduction. Therefore, studying t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00A01H6/46C12Q1/6895C12Q1/6837C12N15/11C40B40/06
CPCC12N9/1007C12Y201/01103C12N15/8271C12Q1/6895C12Q1/6837C40B40/06C12Q2600/13C12Q2600/158
Inventor陈薇兰黄开来樊世军刘艺胥磊袁华涂斌马炳田王玉平钦鹏李仕贵
OwnerSICHUAN AGRI UNIV