A map3k-19 gene and its encoded protein for improving high temperature tolerance in rice heading stage and its application

A 1. MAP3K-19, high temperature tolerance technology, applied in the field of genetic engineering, can solve problems such as lack of MAPK pathway genes

Active Publication Date: 2022-03-08
SICHUAN AGRI UNIV
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no clear report of MAPK pathway genes involved in high temperature stress pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A map3k-19 gene and its encoded protein for improving high temperature tolerance in rice heading stage and its application
  • A map3k-19 gene and its encoded protein for improving high temperature tolerance in rice heading stage and its application
  • A map3k-19 gene and its encoded protein for improving high temperature tolerance in rice heading stage and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Homology comparison analysis of MAP3K family protein sequences

[0026] 1. Homologous gene sequence acquisition

[0027] The protein sequence of rice is from the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu). There are a total of 23 rice samples, and their ID numbers and names are as follows: LOC Os04g35700|MAP3K.16, LOC Os02g35010|MAP3K.9, LOC Os11g10100.2|MAP3K.3, LOC Os04g47240|MAP3K.17, LOC Os02g44642|MAP3K.10, LOC Os07g02780|MAP3K.20, LOC Os03g55560.2|MAP3K.15, LOC Os04g56530|MAP3K.1, LOC Os02g53040|MAP3K.11, LOC Os03g49640|MAP3K.14, LOC Os03g15570|MAP3K130|MAP3K.170, , LOC Os02g21700|MAP3K.8, LOC Os10g04010|MAP3K.23, LOC Os10g04000|MAP3K.22, LOC Os05g46750|MAP3K.18, LOC Os01g50420|MAP3K.7, LOC Os01g50600|MAP3K.5, 9g LOC Os01g50410|MAP3K.6, LOC Os01g50370|MAP3K.4, LOC Os08g32600|MAP3K.21, LOC Os09g21510|MAP3K.2.

[0028] 2. Creation of evolutionary tree

[0029] Use Clustal Omega (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) to alig...

Embodiment 2

[0035] Example 2: Construction of MAP3K-19 gene editing vector

[0036] 1. Gene editing site design

[0037] According to the existing CRISPR / Cas9 construction method in our laboratory, the GTGCGCGAGGTGGGCGGATTCGG sequence containing CGG as the recognition site was selected as the knockout target site of MAP3K-19 on the first exon of MAP3K-19 ( figure 2 ), hoping to obtain loss-of-function transgenic plants to clarify the function of MAP3K-19 gene.

[0038] 2. CRISPR / Cas9 vector construction

[0039] First, mix 5 μL of 10 μM primers before and after the target site, anneal at 99°C for 5 minutes to obtain the sequence containing the double-strand knockout site, and then use Bas1 (NEB Company) to ligate while digesting (37°C) to ligate the sequence of the target site. To the intermediate vector pYLsgRNA-OsU6a, and then use the universal amplification primers CTCCGTTTTACCTGTGGAATCG (UF) and CGGAGGAAAATTCCATCCAC (gR-R) in combination with the back primer and front primer of the...

Embodiment 3

[0046] Example 3: MAP3K-19 gene editing under the background of japonica rice Nipponbare

[0047] 1. Detection of transgenic seedlings

[0048] A total of 15 seedlings were obtained by Agrobacterium infection and transformation. First, the G418 detection primer was used to detect the transformation of the vector, and then the amplification primers U524 (GGACGTGGCCAGGGGGCTCG) + U525 (CATGTCGCTCCACGGC) across the target site were used to amplify the sequences in all the positive transformation plants. Sent to Qingke Sequencing Company for sequencing, the results are as follows Figure 4 As shown, the comparison analysis of the obtained sequences showed that a total of 1 knockout plant with premature termination of protein translation was obtained.

[0049] 2. Phenotype Survey

[0050] In the T1 generation planting, the transgenic lines were divided into 3 repeated plantings in field experiments, and 2 rows were planted for each repeated planting. First, the presence of stable ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a MAP3K‑19 gene for improving the high temperature tolerance of rice at the panicle stage, a protein encoded by it, and an application thereof. The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. The invention provides a new rice panicle-stage high-temperature resistance-related gene, and provides new genetic resources for rice high-temperature-resistant breeding and rice temperature-sensitive male sterile line breeding.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a MAP3K-19 gene for improving the high temperature tolerance of rice heading stage, a protein encoded by it, and an application thereof. Background technique [0002] In recent years, high-temperature heat damage has become more frequent in rice regions around the world, and research on high-temperature related research has gradually attracted the attention of scholars. Progress has been slow (Zhao, C. et al., 2016). At present, the research on the mechanism of high temperature resistance in rice has reported that the genes related to high temperature mainly involve the heat shock protein family, transcription factors, and various enzymes (Ai-Li Qu et al., 2013). [0003] Among the many signaling pathways, the MAPK signaling pathway is an extremely conserved and classic three-level kinase signaling cascade pathway in eukaryotes. The cascade amplification...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/82A01H5/00A01H6/46C12Q1/6895
CPCC12N9/12C12N15/8218C12N15/8271C12Q1/6895C12Y207/11025C12Q2600/13C12Q2600/158
Inventor陈薇兰陈非凡樊世军范文星袁华涂斌马炳田王玉平钦鹏李仕贵
OwnerSICHUAN AGRI UNIV