Unlock instant, AI-driven research and patent intelligence for your innovation.

Reagent for in-vitro detection on mutation of SelS gene promoter and application of reagent in preparation of coronary heart disease screening kit

An in vitro detection and promoter technology, which is applied in the determination/testing of microorganisms, biochemical equipment and methods, etc., can solve the problems of inaccurate positioning of specific sites and fragments, difficulties in CAD prevention and treatment drugs, etc.

Pending Publication Date: 2021-02-09
THE FIRST TEACHING HOSPITAL OF XINJIANG MEDICAL UNIVERCITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can be seen that SelS plays an important role in inflammation and glucose and lipid metabolism, and may be closely related to the occurrence and development of CAD, but the specific sites and fragments are still not precisely located, which leads to the later development of related gene sites or fragments as intervention targets. There are certain difficulties in the prevention and treatment of CAD

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent for in-vitro detection on mutation of SelS gene promoter and application of reagent in preparation of coronary heart disease screening kit
  • Reagent for in-vitro detection on mutation of SelS gene promoter and application of reagent in preparation of coronary heart disease screening kit
  • Reagent for in-vitro detection on mutation of SelS gene promoter and application of reagent in preparation of coronary heart disease screening kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: A coronary heart disease susceptibility gene is a mutated SelS gene promoter, and a test sample containing the SelS gene can be obtained from the blood of the tester. When the SelS gene promoter is mutated, the 84th to 89th positions in the nucleotide sequence table (shown in SEQ ID NO: 1) are deleted.

Embodiment 2

[0035] Embodiment 2: A reagent or kit for detecting SelS gene promoter mutation in vitro, the kit includes primers, probes and amplification reagents.

[0036] The nucleotide sequences of the primers are as follows:

[0037] Upstream primer (the nucleotide sequence is shown in SEQ ID NO: 2 in the sequence listing): GAAATTCGGTAAGAAATCCGTAAC;

[0038] Downstream primer (the nucleotide sequence is shown in SEQ ID NO: 3 of the sequence listing): CGCAACGACTCACCCGTGG;

[0039] The nucleotide sequence of the probe is as follows:

[0040] SelS wild-type TP probe sequence (the nucleotide sequence is shown in SEQ ID NO: 4 in the sequence listing): CTGGGCGGCGGCGGCGGCGGCGGCGGCGGT;

[0041] SelS wild-type BM probe sequence (the nucleotide sequence is shown in SEQ ID NO: 5 in the sequence listing): ACCGCCGCCGCCGCCGCCGCCGCCGCCCAG;

[0042] SelS mutant TP probe sequence (the nucleotide sequence is shown in SEQ ID NO: 6 in the sequence listing): CTGGGCGGCGGCGGCGGCGGCGGT;

[0043] SelS muta...

Embodiment 3

[0045] Example 3: Screening of SelS gene promoter mutation sites

[0046] In this study, 48 patients with coronary heart disease who were hospitalized in the Cardiology Department of the First Affiliated Hospital of Xinjiang Medical University from January 2016 to December 2017 were selected as the sequencing objects.

[0047] Inclusion criteria: CAD group: at least one coronary artery stenosis ≥50% confirmed by percutaneous coronary angiography in our hospital and no other heart disease. Control group: People without any heart disease in the population chronic disease survey in Xinjiang from 2016 to 2019 were selected, and the two groups signed an informed consent form before being included in the study.

[0048] Exclusion criteria: CAD group: patients with incomplete clinical data and one of the following diseases were excluded. (eg: aortic dissection, rheumatic heart disease, congenital heart disease, multiple organ failure, and those with mental disorders who cannot coope...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of detection reagents or kits for coronary heart disease susceptive genes and discloses a reagent for in-vitro detection on mutation of an SelS gene promoter and application of the reagent in preparation of a coronary heart disease screening kit. A nucleotide sequence of the SelS gene promoter is represented by SEQ ID NO: 1 of a sequence listing, and when the SelS gene promoter is mutated, loci 84 to 89 of the nucleotide sequence are deleted. The invention discloses a novel SelS gene promoter mutant site closely related to susceptivity of a coronaryheart disease, and a kit for screening or predicting the coronary heart disease is developed based on the promoter mutant site. According to the application of the SelS gene promoter mutant site disclosed by the invention, early screening of the coronary heart disease can be more accurately achieved from a molecular level, the pertinence is high, and the sensitivity is high.

Description

technical field [0001] The invention relates to the technical field of coronary heart disease susceptibility gene detection reagents or kits, and relates to a reagent for detecting SelS gene promoter mutation in vitro and its application in preparing a coronary heart disease screening kit. Background technique [0002] Coronary Artery Disease (CAD) refers to the occurrence of atherosclerotic lesions in coronary vessels, causing vascular stenosis, obstruction or functional changes of coronary vessels, namely coronary artery spasm, resulting in myocardial ischemia, hypoxia or necrosis. heart disease, also known as coronary atherosclerotic heart disease. Although the rapid development of medical technology has continuously improved the prevention and control system of CAD risk factors, epidemiological studies speculate that the morbidity and mortality of CAD will still show an increasing trend in the next 20 years. CAD is a complex disease, and the research on the etiology, ea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/156
Inventor 谢翔马依彤吴婷婷郑颖颖杨海涛修文娟王凯阳侯宪庚
Owner THE FIRST TEACHING HOSPITAL OF XINJIANG MEDICAL UNIVERCITY