Detection method for establishing gene editing rice based on pyrosequencing technology
A technology of pyrosequencing and gene editing, which is applied in the field of molecular biology and can solve the problems such as the vacancy of gene editing rice detection methods.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] (1) Samples: Test samples 1 and 2 are from the Institute of Plant Protection, Shandong Academy of Agricultural Sciences.
[0040] (2) Reagents: Plant DNA Extraction Kit (TIANGEN), DNA Marker (TaKaRa), GelRed dye, 2×GoTaq Green Master Mix (Promega), disodium oxalate tetraacetate (EDTA·Na2); trimethylol Aminomethane (Tris); Glacial acetic acid; Binding Buffer (QIAGEN); Annealing Buffer (QIAGEN); Washing Buffer (QIAGEN); Sepharose beads (QIAGEN). Specific sequence primers:
[0041] Forward primer sequence: 5'- ACCCTGTGCCACTTCAAAA -3'
[0042] Reverse primer sequence: 5'- GCTTTCTGACTGGTGACAGGTATT -3'
[0043] Sequencing primer sequence: 5'- TGTGGTGTTCCGCTG -3'
[0044] (3) Pyrosequencing PCR amplification system: a total volume of 50 μL, including 25 μL of 2×PCR Master Mix, 1 μL of upstream and downstream primers (10 μmol / L), 2 μL of DNA template (25 ng / μL), Make up to 50 µL with sterile water.
[0045] (4) Pyrosequencing PCR reaction amplification program: pre-denatur...
Embodiment 2
[0049] (1) Gene-edited rice and wild-type rice DNA were uniformly mixed into 6 concentration gradients at the ratio of 100%, 80%, 50%, 25%, 15%, and 0%, and blind samples S7 and S8.
[0050] (2) Reagents: Plant DNA Extraction Kit (TIANGEN), DNA Marker (TaKaRa), GelRed dye, 2×GoTaq Green Master Mix (Promega), disodium oxalate tetraacetate (EDTA·Na2); trimethylol Aminomethane (Tris); Glacial acetic acid; Binding Buffer (QIAGEN); Annealing Buffer (QIAGEN); Washing Buffer (QIAGEN); Sepharose beads (QIAGEN).
[0051] Specific sequence primers:
[0052] Forward primer sequence: 5'- ACCCTGTGCCACTTCAAAA -3'
[0053] Reverse primer sequence: 5'- GCTTTCTGACTGGTGACAGGTATT -3'
[0054] Sequencing primer sequence: 5'- TGTGGTGTTCCGCTG -3'
[0055] (3) Pyrosequencing PCR amplification system: a total volume of 50 μL, including 25 μL of 2×PCR Master Mix, 1 μL of upstream and downstream primers (10 μmol / L), 2 μL of DNA template (25 ng / μL), Make up to 50 µL with sterile water.
[0056] (4)...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap