Supercharge Your Innovation With Domain-Expert AI Agents!

Biological agents for inhibiting response of cells to inflammatory factor stimuli

A technology for inhibiting cells and cytokines, applied in the field of biomedicine, can solve the problem of few types of TNF-α inhibitors

Active Publication Date: 2021-03-12
GUANGZHOU MEDICAL UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] There are few inhibitors of TNF-α in the prior art, so it is necessary to develop new drugs targeting TNF-α to meet the needs of treating different diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological agents for inhibiting response of cells to inflammatory factor stimuli
  • Biological agents for inhibiting response of cells to inflammatory factor stimuli
  • Biological agents for inhibiting response of cells to inflammatory factor stimuli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1Y

[0051] Example 1 YAP knockdown (KD) enhances the expression of TNF-α-induced genes

[0052] RNAiMAX TM Transfection Reagent Transfect control or YAP1 interfering RNA (siRNA) into FLS cells (or HCT-8 cells / THP-1 cells / PBMCs cells; RNAiMAXTM transfection reagent is also used when transfecting HCT-8 cell lines, transfect THP When transfecting PBMC, use control lentivirus or YAP1shRNA lentivirus to infect cells). After 2 days, the control group (treatment method is control siRNA) is not stimulated. The cells in the experimental group were stimulated with TNF-α or LPS, RNA was extracted and interleukin-8 (IL-8) mRNA level was measured by qPCR, and the cell culture supernatant was taken to measure the IL-8 content by ELISA method. The specific operations were as follows:

[0053] 1. Human PBMC isolation and culture

[0054] The use of peripheral blood from healthy adults was approved by the Ethics Committee of Guangzhou Medical University, and the extraction of peripheral blood ob...

Embodiment 2Y

[0077] Example 2 YAP1 knockout enhances the expression of TNF-α-induced genes

[0078] 1. CRISPR / Cas9 gene editing technology

[0079] The human YAP1 gene is knocked out by CRISPR / Cas9 method, and the guideRNA sequence is as follows:

[0080] sgRNA #1: CCCTGCGGGGGCTGCGAAGG

[0081] sgRNA #2: ACCCGGGCAACCGGCACCCG.

[0082] The two sgRNAs were integrated into the vector pGE-4 (pU6gRNA1UgRNA2Cas9puro), and the constructed YAP1 KO plasmid was transfected into cells using standard experimental procedures, and then screened with 2 μg / ml puromycin after transfection.

[0083] 2. Western blotting (WB): according to the standard experimental procedure, all the antibodies used were purchased from Cell Signaling Technology.

[0084] 3. Results

[0085] The present invention uses CRISPR / Cas9 to knock out the proline-rich region (PRD) of YAP1 in HCT-8 cells, the results are as follows Figure 5 as shown, Figure 5 A shows, compared with the control group C (control plasmid empty), af...

Embodiment 3Y

[0087] Example 3 Effect of YAP1 on TNF-α signaling pathway

[0088] Acting on cells, TNF-α rapidly activates multiple pathways, leading to transcription of many genes including cytokines and chemokines. Among these signaling pathways, the NF-κB and MAP kinase pathways are critical.

[0089] In this example, the effect of YAP1 on the TNF-α signaling pathway was studied by examining the effect of YAP1 knockout and YAP1 knockdown on NF-κB and MAP kinase pathways (using Western blot method).

[0090] The result is as Figure 6 As shown, both YAP1 knockdown (KD) and knockout (KO) significantly enhanced the phosphorylation level of p65 (phosphorylated p65 is p-p65, which is one of the components of the NF-κB pathway), and the phosphorylation levels of p38 and ERK (Phosphorylated p38, namely p-p38 and phosphorylated ERK, namely p-ERK, are elements of the MAP kinase family); indicating that knockdown or knockout of YAP1 can enhance the TNF-α signaling pathway.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological medicines, and discloses a biological agent for inhibiting response of cells to inflammatory factor stimulation, the biological agent comprises a PRD peptide fragment and / or a TAD peptide fragment, the amino acid sequence of the PRD peptide fragment is shown as SEQ ID NO: 1, and the amino acid sequence of the PRD peptide fragment is shownas SEQ ID NO: 2. Through a molecular biological analysis method, the PRD peptide fragment is found to be a positive regulation region for inhibiting inflammatory stimuli response in YAP1 protein, andthe TAD peptide fragment is found to be a negative regulation region for inhibiting inflammatory stimuli response in YAP1 protein; both the PRD peptide fragment and the TAD peptide fragment can inhibit signaling pathways of TNF-alpha, IL1-beta and LPS, and the PRD peptide fragment and / or the TAD peptide fragment can be used in diseases caused by excessive cytokines, so that a new way is provided for immunotherapy.

Description

technical field [0001] The present invention relates to the technical field of biomedicine, and more specifically, relates to a biological preparation for inhibiting the response of cells to stimulation by inflammatory factors. Background technique [0002] When human cells are infected by microorganisms, the transcription of some genes increases, thereby translating proteins that help eliminate pathogens. Some of these genes produce cytokines or chemokines that are critical for fighting pathogens. Lipopolysaccharide LPS from Gram-negative bacteria is currently known to be the strongest stimulus that can cause the expression of the above genes to be upregulated. The upregulated genes include TNFα and IL-1β, which can in turn induce the production of other cytokines and chemokines , so TNF-α and IL-1β themselves can aggravate the inflammation caused by infection. [0003] However, overactivation of some genes can damage the body. Sepsis is no stranger to us. It is a very s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/16A61P29/00
CPCA61K38/16A61P29/00A61P37/06A61K38/1709A61K38/10
Inventor 李钟大杨丰源沈丽亚范登霞
Owner GUANGZHOU MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More