Co-transcription unit gene ABE-CBE system for bidirectional single base editing of rice and application thereof

An ABE-CBE, single-base technology, applied in the field of biotechnology and plant genetic engineering, can solve the problems of fixed-point modification dependence, low efficiency, and the ability to edit genes accurately, so as to achieve wide application value and reduce unexpected bases The effect of replacing

Active Publication Date: 2021-03-19
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI +1
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although CRISPR / Cas9 can efficiently target the target gene, its site-directed modification relies on the inefficient homologous recombination mechanism, so the ability to precisely edit genes needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Co-transcription unit gene ABE-CBE system for bidirectional single base editing of rice and application thereof
  • Co-transcription unit gene ABE-CBE system for bidirectional single base editing of rice and application thereof
  • Co-transcription unit gene ABE-CBE system for bidirectional single base editing of rice and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0119] Example 1 - Splicing of the mutant TadA-nSpCas9-LjCDAL1 gene

[0120] The gene of the present application is named mutant TadA-nSpCas9-LjCDAL1, and its sequence is shown in SEQ ID NO:1.

[0121] First, through a large number of experiments, the applicant designed and screened a lamprey-like cytosine deaminase (cytidine deaminase, LjCDAL1) gene with a wide window and high editing efficiency, named Os-LjCDAL1 (sequence such as SEQ ID NO: 2 ), its editing efficiency can reach more than 80%. After the Os-LjCDAL1 gene was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis, it was connected to the PUC57-AMP vector to form the PUC57-AMP-LjCDAL1 vector, and loaded into E. coli XL-blue strain.

[0122] Secondly, the mutant adenine deaminase TadA suitable for rice was artificially synthesized, named mutant TadA, connected to the PUC57-AMP vector to form the PUC57-AMP-mutant TadA vector, and loaded into E. coli XL-blue strain .

[0123] According to the Gibson splic...

Embodiment 2

[0133] Example 2—Construction of plant targeting vector containing mutant TadA-nSpCas9-LjCDAL1 gene

[0134] From Escherichia coli XL-blue containing the mutant TadA-nSpCas9-LjCDAL1 vector, use the Axygen plasmid extraction kit to extract the plasmid, digest it with NotI / SacI, and recover the OsSpCas9-LjCDAL1 fragment. At the same time, pHUC411 was linearized using NotI / SacI enzymes, pHUC411 was recovered, and the above-mentioned mutant TadA-nSpCas9-LjCDAL1 fragment and pHUC411 fragment were connected with T4 ligase (purchased from TaKaRa Company) to obtain the plant expression vector pHUC411mutant TadA-nSpCas9 -LjCDAL1( figure 1 ), named pHUC411-TadA-LjCDAL1.

[0135] Select the nucleotide sequence CGGCGACGGCGAGCAAGTGG of position 3105-3124 in rice NRT1.1 gene (Os10g0554200) AGG , (the underlined part is the PAM sequence of the 5'NGG-3' structure), as the targeting site. The target site sequence was fused to pHUC411-TadA-LjCDAL1 to form pHUC411-TadA-LjCDAL1-NRT1.1. The p...

Embodiment 3

[0136] Example 3—Genetic transformation of rice using pHUC411-TadA-LjCDAL1-NRT1.1 as a targeting vector and acquisition of mutants.

[0137] 1. Induction and pre-culture of mature embryo callus

[0138] The mature seeds of Nipponbare are shelled, and the seeds with normal appearance and cleanness without mildew are selected, shaken for 90 sec with 70% alcohol, and poured off the alcohol; Add 1 drop of Tween20) solution to 1 ml to wash the seeds, and shake on the shaker for 45min (180r / min). Pour off the sodium hypochlorite, wash with sterile water 5-10 times until there is no smell of sodium hypochlorite, finally add sterile water, soak overnight at 30°C. Use a scalpel to separate the embryos along the aleurone layer, put the scutellum up on the induction medium (see Table 1 for ingredients), 12 embryos / dish, and culture in the dark at 30°C to induce callus.

[0139] Two weeks later, spherical, rough, light yellow secondary callus appeared, and pre-cultivation operation coul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a co-transcription unit gene ABE-CBE system for the bidirectional single base editing of rice, a vector and application thereof. A co-transcription unit gene ABE-CBE comprises an adenine deaminase coding gene TadA and a cytosine deaminase coding gene CDA, and the coding sequences of co-transcription unit genes mutant TadA and LjCDAL1 are constructed in the same expression vector. An expression vector containing a cytosine base editor and an adenine base editor is fused, so that the nucleotide replacement of specific sites of a genome is caused. Experiments prove that a designed fusion editing tool is used for constructing a plant expression vector, and then a rice targeting editing vector is constructed, so that after the gene is introduced into rice cells, the efficiency of the mutual replacement of A:T to G:C on DNA of a rice specific gene locus is improved, the simultaneous replacement of C to T and A to G can be realized at the specific locus of the gene, theapplication range is expanded, and meanwhile, off-target generation is reduced. Therefore, a fused A-C base editing system is enabled to have a wider application prospect.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and plant genetic engineering. Specifically, the present invention relates to the fusion and application of two base editors. Background technique [0002] Gene editing technology is one of the disruptive technologies that have made breakthroughs in recent years. The CRISPR / Cas9 gene editing system is simple and efficient, and is widely used in gene function research and utilization. Although CRISPR / Cas9 can efficiently target target genes, its site-directed modification relies on the inefficient homologous recombination mechanism, so the ability to precisely edit genes needs to be improved. Single base editing technology (base editor, BE) forms a fusion protein with Cas9 nickase (Cas9 nikase, Cas9n) or nuclease-free Cas9 (nuclease dead Cas9, dCas9) and cytosine deaminase, and through sgRNA ( Single-stranded guide RNA) targets the fusion protein to the target site, and performs precise a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/84C12N15/66C12N15/55C12N15/29C12N15/10A01H5/00A01H6/46
CPCC12N15/8218C12N15/8243C12N15/66C12N9/78C12N9/22C07K14/415C12N15/102C12Y305/04002C12Y305/04001
Inventor许蓉芳李娟秦瑞英孔凡娜徐丽媛冯睿彤魏鹏程
OwnerRICE RES ISTITUTE ANHUI ACAD OF AGRI SCI