R gene for controlling soybean-rhizobium matching property as well as protein and application thereof

A rhizobia and matching technology, applied in application, genetic engineering, plant genetic improvement, etc., to achieve the effect of improving symbiotic nitrogen fixation ability

Active Publication Date: 2021-04-09
HENAN UNIVERSITY +1
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention proposes an R gene for controlling soybean-rhizobia compatibility and its protein and its application, which solves the regulation of soybean-rhizobia compatibility and how to use the compatibility of soybean and rhizobia to improve soybean nitrogen fixation capacity, thereby improving Technical Problems of Soybean Utilization Efficiency of Nitrogen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • R gene for controlling soybean-rhizobium matching property as well as protein and application thereof
  • R gene for controlling soybean-rhizobium matching property as well as protein and application thereof
  • R gene for controlling soybean-rhizobium matching property as well as protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027]The present application constructs the core germplasm of cultivation soybeans. It is a method of simultaneously affecting the number of soybean roots in soybeans, a single biovistribution of soybean roots, and GMNNL1. Through haplotype analysis, the six major haplotypes of GMNNL1 were found, only GMNNL1HT1 (Sequence, such as SEQ ID NO.1) can be normally encoded into a typical R protein of TIR-NBS-LRR, other five haplotypes (sequences such as SEQID No. 4, SEQ ID NO.5, SEQ ID No.6, SEQ ID NO. 7 or SEQ ID NO.8) Both the insertion of a transposon GMSine1 or the deletion of a single base results in a non-intact protein form (figure 1 ). Through haplotype analysis, it has GMNNL1HT1 The number of root tumors of haplotype soy is significantly lower than other haplotypes (Fig. 2), by comparing the complete form of the R protein structure, GMNNL1HT1 And non-complete forms of GMNNL1HT2-HT6 , Found with GMNNL1HT1 Single-type soybean monitase activity and ground parts are significantly low...

Embodiment 2

[0032]The gene sequence of GMNNL1 is obtained by the following method:

[0033]The total volume of the reaction system is 50 μl, and the template is a soybean-stranded peony-peat-generator DNA 1 μL (about 50 ng), 10 × KOD enzyme reaction buffer 5 μL, 25mm mgCl2 2 μL, 5 mM DNTP 5 μL, 5 μL of 5 μL (primers NNL1-F and NNL1-R, each primer is 2.5 μL), 1 μl of KOD enzyme, DDH2O (sterile peeled water) to 50 μL. The reaction procedure was: 94 ° C degeneration 5 min, 94 ° C 30s, 55 ° C for 1 min, 68 ° C 3.5 min 35 cycles, and extends at 68 ° C for 10 min. The primers were: NNL1-F: atggcacagaacagcaccatct; NNL1-R: TcatttaAcaactagtacaaac; finally obtained gene sequence containing the nucleotide of SEQ IDNO.2, which encoded the protein as shown in SEQ ID NO.3.

[0034]The protective content of the present invention further includes a nucleotide sequence corresponding to the amino acid sequence shown in SEQ ID NO. And also includes sequences shown in SEQ ID NO to pass through the modified protein havin...

Embodiment 3

[0036]Gmnnl1 genes are used in regulating soy-rhizobium, and the application process is as follows:

[0037]The promoter and full length CDS of Gmnnl1 in HFWD were cloned to the PUB-GFP, transfer to Williams82 (WS82, GMNNL1)HT2 In the obtained transgenic system, USDA110 is inoculated, GMNNL1HT1 The higher the expression quantity, the less the number of root tumors (Fig. 6). Therefore, the tumor of a particular type of rhizobium can therefore be reduced by this method. The specific process is:

[0038](1) The GMNNL1 promoter region is obtained by:

[0039]The total volume of the reaction system is 50 μl, and the template is a cross-pem-bean genome DNA 1 μL (about 50 ng), 1 × KOD enzyme reaction buffer 5 μL, 25mm mgCl2 2 μL, 5 mM DNTP 5 μL, 5UM primer 5 μL (primers PNNL1-F and PNNL1-R 2.5 μL), 1 μl of KOD enzyme, DDH2O (sterile peeled water) to 50 μL. The reaction procedure was: 94 ° C degeneration 5 min, 94 ° C 30s, 55 ° C 1 min, 68 ° C 2 min 35 cycles, and 68 ° C extends for 10 min. The prim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and relates to application of a new gene, in particular to an R gene for controlling soybean-rhizobium matching property as well as protein and application of the R gene. The GmNNL1 genome sequence of the gene GmNNL1 disclosed by the invention in the HENGFENG WUDOU of a soybean line is as shown in SEQ ID NO. 2 and the coded amino acid sequence is as shown in SEQ ID NO. 3. The R gene GmNNL1 of the soybean is an effective gene capable of regulating and controlling the nodulation quantity of specific rhizobium on the soybean, and can regulate and control the nodulation quantity by directly identifying the haplotype of slow-growing rhizobium specific effect protein NopP to limit the symbiotic nodulation of indigenous rhizobium, so that the soybean preferentially nodulates with artificially applied efficient rhizobium inoculant; and the symbiotic nitrogen fixation capability can be improved.

Description

Technical field[0001]The present invention belongs to the field of biotechnology, involving the application of new genes, particularly a R gene and its protein and applications that control the matching of soybean-rhizobium.Background technique[0002]Cultivated soybeans [Glycine Max (L.) MERR] originated in my country, is an important food, feed, oil and energy crop in the world, one of the traditional "five valleys" is an important part of people's daily diet (Palander et al. " , 2005). At the same time, with the pressure of my country's economic development and population surges on food demand, my country has a large amount of fertilizers in food production, of which nitrogen fertilizer is most. According to the statistics of World FAO FAO, my country's annual nitrogen use is constantly rising, although my country's cultivated land is only 8% of the world, but the use of nitrogen has reached 35% of the total use of total worldwide ( http: / / faostat.fao.org / ). Excessive application a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/11C12N15/84C12N15/82C12N15/113A01H6/54A01H5/06C12Q1/6895
CPCC07K14/415C12N15/8261C12N15/8227C12Q1/6895C12Q2600/158C12Q2600/13
Inventor王学路张豹李友国
OwnerHENAN UNIVERSITY