Unlock instant, AI-driven research and patent intelligence for your innovation.

A dual-signal method for the detection of foodborne pathogens based on nucleic acid conformation-initiated strand displacement-driven DNA Walker

A chain-substitution and dual-signal technology is applied in the field of detecting Salmonella typhimurium, which can solve the problems of undisclosed electrochemiluminescence sensors, and achieve the effects of rapid preparation, large specific surface area and convenient operation.

Active Publication Date: 2022-05-24
NINGBO UNIV
View PDF16 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no relevant research reports on the preparation method and application of the electrochemiluminescent sensor for the detection of Salmonella typhimurium based on nucleic acid conformation-triggered strand substitution to drive DNA Walker's dual-signal detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A dual-signal method for the detection of foodborne pathogens based on nucleic acid conformation-initiated strand displacement-driven DNA Walker
  • A dual-signal method for the detection of foodborne pathogens based on nucleic acid conformation-initiated strand displacement-driven DNA Walker
  • A dual-signal method for the detection of foodborne pathogens based on nucleic acid conformation-initiated strand displacement-driven DNA Walker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] A dual-signal detection method for Salmonella typhimurium based on nucleic acid conformation-primed strand substitution-driven DNA Walker, such as figure 1 shown, including the following steps:

[0033] (1) Mix equal volumes of 15 µmol / L DNA Walker swing arm chain solution and 15 µmol / L protective probe solution containing the Salmonella typhimurium aptamer to be tested, and place it at 95 °C for deformation for 8-12 min. Slowly lowered to room temperature to form the protected DNA Walker chain solution; the solvent of the swing arm chain solution and the protection probe solution are both oligonucleotide storage solutions; the sequence of the Salmonella typhimurium aptamer is TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG; the corresponding protection probe The sequence of the needle is: 5'-CTTCAAGGCTAACATGGTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAGGAGGCAAGTGATCCGG-3'; the sequence of the DNA Walker swing arm chain is: 5'-NH 2 -TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACTTGGATC...

Embodiment 2

[0042] With above-mentioned embodiment 1, its difference is:

[0043] (1) Mix equal volumes of 10 µmol / L DNA Walker swing arm chain solution and 10 µmol / L protective probe solution containing the Salmonella typhimurium aptamer to be tested, and the oligonucleotide storage solution is pH=7 containing 1 mM EDTA and 10 mM MgCl 2 •6H 2 O in 30 mM Tris-HCl buffer solution;

[0044] (2) Add 3 µL of nucleic acid dye that can intercalate between double strands (LC Green Plus nucleic acid dye) into 500 µL of 8 µM hairpin substrate strand solution, shake at room temperature for 4-6 min;

[0045] (3) Mix 1 mL of 10 mg / mL aminated ferric oxide and 50 µL of glutaraldehyde, stir at room temperature for 50 min, magnetically wash and suspend in 2 mL of oligonucleotide stock solution, and then add the well-mixed solution. Homogenize 50 µL of 10 µM protected DNA Walker strand solution and 500 µL of 8 µM hairpin substrate strand mixture, react at 35 °C for 20 min, and make up to 2 mL with oli...

Embodiment 3

[0048] With above-mentioned embodiment 1, its difference is:

[0049] (1) After mixing equal volumes of 20 µmol / L DNA Walker swing arm chain solution and 20 µmol / L protective probe solution containing the Salmonella typhimurium aptamer to be tested, the oligonucleotide storage solution is pH=9 with 3 mM EDTA and 13 mM MgCl 2 •6H 2 O in 50 mM Tris-HCl buffer solution;

[0050] (2) Add 5 µL of nucleic acid dye that can intercalate between double strands (LC Green Plus nucleic acid dye) into 600 µL of 5 µM hairpin substrate strand solution, shake at room temperature for 4-6 min;

[0051] (3) Mix 2 mL of 5 mg / mL aminated ferric tetraoxide and 100 µL of glutaraldehyde, stir at room temperature for 70 min, magnetically wash and suspend in 5 mL of oligonucleotide stock solution, and then add the well-mixed solution. Homogenize 60 µL of 5 µM protected DNA Walker strand solution and 600 µL of 5 µM hairpin substrate strand mixture, react at 38 °C for 40 min, and make up to 5 mL with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
recovery rateaaaaaaaaaa
recovery rateaaaaaaaaaa
Login to View More

Abstract

The invention discloses a double-signal detection method for food-borne pathogenic bacteria based on nucleic acid conformation-triggered strand substitution-driven DNA Walker, which is characterized in that it comprises a DNA Walker swing arm chain solution and an aptamer containing food-borne pathogenic bacteria to be tested. The protected probe solution is mixed in equal volumes and reacted slowly to room temperature to form a protected DNA Walker chain solution; the aminated ferric oxide and glutaraldehyde are mixed, stirred at room temperature, magnetically cleaned, and then suspended in the oligo In the nucleotide storage solution, add the fully mixed Walker strand solution and the hairpin substrate strand mixture to react, after magnetic washing, use the oligonucleotide storage solution to make up the volume, and mix with the solution to be tested, the substituted strand solution and the content Dicer solution was mixed and incubated, and the supernatant was taken for fluorescence detection, and the precipitate was dropped on a magnetic glassy carbon electrode for electrochemiluminescence detection. The advantages are high sensitivity, high selectivity, and simple and fast operation.

Description

technical field [0001] The invention relates to a method for detecting Salmonella typhimurium, in particular to a method for detecting food-borne pathogenic bacteria based on the double-signal detection of DNA Walker driven by nucleic acid conformation priming strands. Background technique [0002] Salmonella typhimurium is a common anaerobic gram-negative bacterium that is widely distributed in the environment and can be transmitted to humans through contaminated poultry, eggs, milk, fish and meat products. Enteritis caused by Salmonella typhimurium is estimated to kill 1 million people each year. With the enhancement of people's awareness of food safety, the development of a rapid, efficient, simple and specific detection method for Salmonella typhimurium has become an inevitable trend in the field of food safety and hygiene inspection. [0003] DNA Walker is a dynamic DNA walker that imitates natural molecular motion. Nucleic acids can move along tracks assembled by DNA....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/682C12Q1/14C12Q1/10C12Q1/04G01N21/76G01N27/30G01N27/327C12R1/42C12R1/445C12R1/63
CPCC12Q1/689C12Q1/682G01N21/76G01N27/308G01N27/3275C12Q2525/205C12Q2525/301C12Q2521/307C12Q2563/173C12Q2563/143C12Q2563/149
Inventor 郭智勇卫文婷郝婷婷王照亮林晗
Owner NINGBO UNIV