Application of gliotoxin-resistant self-protection gene glik in assisting host cells to resist gliotoxin
A gliotoxin and gene protection technology, applied in the field of genetic engineering, can solve the problems of reducing immune activity, imbalance of redox reaction, and induction of cell apoptosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Acquisition of deep-sea fungus Geosmithiapallida FS140 anti-gliotoxin self-protection gene sequence
[0021] Amplification of gene GliK: Inoculate the deep-sea fungus Geosmithiapallida FS140 on YPD medium plate, culture at 37°C for 72h, pick fresh mycelium, extract RNA with fungal RNA extraction kit, and reverse it with All-in-oneRTMaster Kit recorded to obtain cDNA. According to the transcriptome sequencing results, the GliK sequence encoding the anti-trichothecenes self-protection gene was predicted, and specific primers were designed upstream and downstream. The primer sequences were GliK-F: 5'-ATGACCATACAACTCCCCTCACAC-3'; GliK-R: 5' -AGCGGAGGGCTGGGCGTAGC-3', amplified with cDNA library as template to obtain PCR product ( figure 2). The product was recovered and TA cloned with pEASY-T1 kit, transformed into E. coli competent cells, spread on ampicillin-resistant plates to screen out positive clones, and universal primers M13-F (5′-GTAAAACGACGGCCAGT-3′) a...
Embodiment 2
[0022] Example 2 Functional verification of anti-gliotoxin self-protection gene GliK
[0023] The gene GliK was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early construction plasmid, carrying the constitutive promoter TEF1 and terminator CYC1, see the vector map image 3 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, Shuang Li, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomyces cerevisiae to produce(+)-valencene and its related sesquiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First, the upstream and downstream primers YEp352-GliK-F and YEp352-GliK-R were designed for the amplification of the gene GliK (SEQ ID NO. 1). The primer sequences are YEp352-GliK-F: 5'- AGCAATCTAATCTAAGTCTAGA ATGACCATACAACTCCCTCACAC-3';YEp352-GliK-R:5'- TTACATGATGCGGCCCGTCGAC AGCGGAGGGCTGGGCGTAGC-3' (the underlined sequence is the homology arm fragment...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



