Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of gliotoxin-resistant self-protection gene glik in assisting host cells to resist gliotoxin

A gliotoxin and gene protection technology, applied in the field of genetic engineering, can solve the problems of reducing immune activity, imbalance of redox reaction, and induction of cell apoptosis

Active Publication Date: 2022-05-24
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The toxicity of gliotoxin to the host mainly includes: inducing apoptosis; causing redox reaction imbalance; inhibiting proteasome activity, leading to the inhibition of NF-κB activity, reducing immune activity, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gliotoxin-resistant self-protection gene glik in assisting host cells to resist gliotoxin
  • Application of gliotoxin-resistant self-protection gene glik in assisting host cells to resist gliotoxin
  • Application of gliotoxin-resistant self-protection gene glik in assisting host cells to resist gliotoxin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Acquisition of deep-sea fungus Geosmithiapallida FS140 anti-gliotoxin self-protection gene sequence

[0021] Amplification of gene GliK: Inoculate the deep-sea fungus Geosmithiapallida FS140 on YPD medium plate, culture at 37°C for 72h, pick fresh mycelium, extract RNA with fungal RNA extraction kit, and reverse it with All-in-oneRTMaster Kit recorded to obtain cDNA. According to the transcriptome sequencing results, the GliK sequence encoding the anti-trichothecenes self-protection gene was predicted, and specific primers were designed upstream and downstream. The primer sequences were GliK-F: 5'-ATGACCATACAACTCCCCTCACAC-3'; GliK-R: 5' -AGCGGAGGGCTGGGCGTAGC-3', amplified with cDNA library as template to obtain PCR product ( figure 2). The product was recovered and TA cloned with pEASY-T1 kit, transformed into E. coli competent cells, spread on ampicillin-resistant plates to screen out positive clones, and universal primers M13-F (5′-GTAAAACGACGGCCAGT-3′) a...

Embodiment 2

[0022] Example 2 Functional verification of anti-gliotoxin self-protection gene GliK

[0023] The gene GliK was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early construction plasmid, carrying the constitutive promoter TEF1 and terminator CYC1, see the vector map image 3 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, Shuang Li, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomyces cerevisiae to produce(+)-valencene and its related sesquiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First, the upstream and downstream primers YEp352-GliK-F and YEp352-GliK-R were designed for the amplification of the gene GliK (SEQ ID NO. 1). The primer sequences are YEp352-GliK-F: 5'- AGCAATCTAATCTAAGTCTAGA ATGACCATACAACTCCCTCACAC-3';YEp352-GliK-R:5'- TTACATGATGCGGCCCGTCGAC AGCGGAGGGCTGGGCGTAGC-3' (the underlined sequence is the homology arm fragment...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of the gliotoxin-resistant self-protection gene GliK in assisting host cells to resist gliotoxin. The nucleotide sequence of the anti-gliotoxin self-protection gene GliK is shown in SEQ ID NO.1. Therefore, the present invention obtained the anti-gliotoxin self-protection gene GliK sequence from the cDNA library of the deep-sea fungus FS140, and successfully introduced it into S. The ability to enhance the heterologous expression level of gliotoxins and obtain new gliotoxins lays the foundation for molecular biology.

Description

technical field [0001] The invention belongs to the field of genetic engineering, in particular to the application of an anti-gliotoxin self-protection gene GliK in assisting host cells to resist gliotoxin. Background technique [0002] In the early stage, our research group isolated more than 20 gliotoxin-like compounds from the deep-sea fungus Geosmithia pallida FS140, including gliotoxin-like dimer compounds with rare structures, most of which have obvious antitumor activity. . [0003] Gliotoxin (GT) is a class of diketopiperazine compounds (epipolythiodioxopperazine, ETP), ETP is an important virulence factor, which produces specific toxicity to various cells through different pathways, and is involved in invasive aspergillosis. play an important synergistic role. ETP exerts toxic side effects mainly through disulfide bonds, cross-linking of sulfhydryl groups and target proteins to inactivate the protein activity, and can generate toxic reactive oxygen species (ROS) t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/81C12N15/80C12N1/19C12N1/15C12R1/865C12R1/645
Inventor 李赛妮章卫民叶伟张维阳
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY