Protein related to plant flowering period as well as coding gene and application of protein

A coding gene and plant technology, applied in the field of protein and its coding gene and application, can solve the problems of early flowering, difficulty in soybean promotion, grain failure, etc.

Active Publication Date: 2021-05-11
CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The planting range of a single variety is relatively narrow
When soybeans are introduced in different latitudes, the flowering period is often advanced or delayed due to changes in the length of sunshine, resulting in a decrease in yield or even no harve...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein related to plant flowering period as well as coding gene and application of protein
  • Protein related to plant flowering period as well as coding gene and application of protein
  • Protein related to plant flowering period as well as coding gene and application of protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Embodiment 1, the cloning of GmMASB1 gene

[0080] The material selected in this embodiment is soybean variety Qihuang 34. This variety was published in the document "Zhang Yanwei, Li Wei, Zhang Lifeng, etc. Genome-wide variation mining of new soybean variety Qihuang 34 based on resequencing. Chinese Journal of Oil Crops, 2016, 38(02), 150-158", Publicly available from the Crop Research Institute of Shandong Academy of Agricultural Sciences.

[0081] 1. Sow the soybean material Qihuang 34, treat it with long day (14h light / 10h dark) after it emerges, take its single leaf after 9 days and extract RNA, and use the obtained RNA as a template to reverse transcribe to obtain cDNA.

[0082] 2. Using the cDNA obtained in step 1 as a template, PCR amplification was performed using primers GmMASB1-F: ATGGGAAGAGGGAAGGTGGTTCT and GmMASB1-R: TTATGACTGCTTTGGCCTCAACCA to obtain PCR amplification products. and sequence it.

[0083] Sequencing results show that the nucleotide sequen...

Embodiment 2

[0084] Example 2, the acquisition of transgenic GmMASB1 Arabidopsis and its functional verification

[0085] The pCAMBIA3300s vector used in this example (in the literature "Ren Guoyong, Li Wei, Zhang Lifeng, etc. Resistance identification of cyst nematode disease No. ” is a modified vector obtained by adding the 35S promoter sequence (nucleotides 8328-9004 of Sequence 3 in the Sequence Listing) to the commercial vector pCAMBIA3300, and pCAMBIA3300s is shown in Sequence 3 in the Sequence Listing DNA molecule.

[0086] 1. Obtaining transgenic GmMASB1 Arabidopsis

[0087] 1.1 Construction of recombinant expression vector pCAMBIA3300s-GmMASB1

[0088] (1) Recover and purify the PCR amplification product amplified in Example 1 to obtain the recovered purified product, then use the recovered purified product as a template, and use the primer GmMASB1-HR-F:5'- TCTCGAGCTTTCGCGAGCTC ATGGGAAGAGGGAAGGTGG-3', GmMASB1-HR-R:5'- AGGTCGACTCTAGAGGATCC TTATGACTGCTTTGGCCTCAAC-3' was amplif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a protein related to a plant flowering period as well as a coding gene and application of the protein. According to the technical scheme, the protein derived from soybeans is applied to regulation and control of plant flowering or shortening of the plant flowering period, the name of the protein is GmMASB1, and the protein can be the protein with the amino acid sequence being a sequence 2 in a sequence table. The gene GmMASB1 is cloned from the soybean variety Qihuang 34, and is over-expressed in arabidopsis thaliana to obtain a transgenic GmMASB1 plant, and the flowering period of the transgenic GmMASB1 plant is obviously earlier than that of a non-transgenic wild type, so that the GmMASB1 protein has a flowering promoting effect and can be applied to plant breeding or variety breeding.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a protein related to the flowering period of a plant, its coding gene and its application. Background technique [0002] In the process of growth and development, plants are affected by multiple external environments and their own factors, and will undergo multiple growth stages of transformation, the most important and symbolic of which is the transformation from vegetative growth to reproductive growth. This shift determines when a plant blooms, which in turn can greatly affect or even determine a plant's fitness for a given area. [0003] Soybean is a typical short-day crop, and there are differences in the responses of soybean varieties to short-day in the same latitude. As a result, the planting range of a single variety is relatively narrow. When soybeans are introduced in different latitudes, the flowering period is often advanced or delayed due to changes in the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/02A01H6/20
CPCC07K14/415C12N15/827
Inventor 刘薇张彦威王玉斌张礼凤李伟王彩洁徐冉
Owner CROP RES INST SHANDONG ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap