Protein related to plant flowering period as well as coding gene and application of protein
A coding gene and plant technology, applied in the field of protein and its coding gene and application, can solve the problems of early flowering, difficulty in soybean promotion, grain failure, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Embodiment 1, the cloning of GmMASB1 gene
[0080] The material selected in this embodiment is soybean variety Qihuang 34. This variety was published in the document "Zhang Yanwei, Li Wei, Zhang Lifeng, etc. Genome-wide variation mining of new soybean variety Qihuang 34 based on resequencing. Chinese Journal of Oil Crops, 2016, 38(02), 150-158", Publicly available from the Crop Research Institute of Shandong Academy of Agricultural Sciences.
[0081] 1. Sow the soybean material Qihuang 34, treat it with long day (14h light / 10h dark) after it emerges, take its single leaf after 9 days and extract RNA, and use the obtained RNA as a template to reverse transcribe to obtain cDNA.
[0082] 2. Using the cDNA obtained in step 1 as a template, PCR amplification was performed using primers GmMASB1-F: ATGGGAAGAGGGAAGGTGGTTCT and GmMASB1-R: TTATGACTGCTTTGGCCTCAACCA to obtain PCR amplification products. and sequence it.
[0083] Sequencing results show that the nucleotide sequen...
Embodiment 2
[0084] Example 2, the acquisition of transgenic GmMASB1 Arabidopsis and its functional verification
[0085] The pCAMBIA3300s vector used in this example (in the literature "Ren Guoyong, Li Wei, Zhang Lifeng, etc. Resistance identification of cyst nematode disease No. ” is a modified vector obtained by adding the 35S promoter sequence (nucleotides 8328-9004 of Sequence 3 in the Sequence Listing) to the commercial vector pCAMBIA3300, and pCAMBIA3300s is shown in Sequence 3 in the Sequence Listing DNA molecule.
[0086] 1. Obtaining transgenic GmMASB1 Arabidopsis
[0087] 1.1 Construction of recombinant expression vector pCAMBIA3300s-GmMASB1
[0088] (1) Recover and purify the PCR amplification product amplified in Example 1 to obtain the recovered purified product, then use the recovered purified product as a template, and use the primer GmMASB1-HR-F:5'- TCTCGAGCTTTCGCGAGCTC ATGGGAAGAGGGAAGGTGG-3', GmMASB1-HR-R:5'- AGGTCGACTCTAGAGGATCC TTATGACTGCTTTGGCCTCAAC-3' was amplif...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



