Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

E3 ubiquitin ligase trim50-like protein of Penaeus monodon and its application

A technology of ubiquitin ligase and Penaeus monodon, which is applied in the direction of ligase, peptide/protein components, enzymes, etc., to reduce the amount of replication and improve the survival rate

Active Publication Date: 2022-04-01
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no effective control and treatment for the outbreak of WSSV disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • E3 ubiquitin ligase trim50-like protein of Penaeus monodon and its application
  • E3 ubiquitin ligase trim50-like protein of Penaeus monodon and its application
  • E3 ubiquitin ligase trim50-like protein of Penaeus monodon and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Spotstown to shrimp E3 ubiquitin ligase Trim50-Like protein

[0035] (1) Extraction of total RNA

[0036] Take the fresh healthy spots to tissue the shrimp stocks, and the total RNA was extracted according to the Qiagen Mini kit, and the total RNA was extracted and the genome was removed using DNase.

[0037] (2) Preparation of full length cDNA template

[0038] PRIMEScript TM II 1st Strand CDNA Synthesis Kit (Takara) Manual Preparation Full-length CDNA Template, 1 μL of total RNA is added 1 μL Oligo DT Primer, 1 μL DNTP MIXTURE (10mmeach), plus RNase Free DDH 2 O Suppleed to 10 μL. Mix the above solution, centrifuge, 65 ° C for 65 ° C, 5 min after 5 min, and cool the template RNA after 5 min. The following reagents were sequentially added: 4 μL5 × primescriptii, 0.5 μL inhibitor (40U / μL), 1 μL Primescript II Rtase (200U / μL) and RNASefree DDH 2 O. The following react procedures were carried out: 30 ° C 10 min, 42 ° C 15 min, 95 ° C for 5 min, and 4 ° C were co...

Embodiment 2

[0063] Example 2 TRIM50-LIKE protein polyclonal antibody preparation

[0064] The purified TRIM50-LIKE recombinant protein (about 100-200 μg) was fully mixed with 3 ml complete Freund adjuvant, and 8 mice were injected at a multi-point injection at a mouse skin. . Immunization 3 times after the first injection of 3 weeks. The reinforcing amount of 10-20 μg protein is used to emulsify using an incomplete Frego adjuvant. Each injection is 10 days. After the fourth injection, mice were removed from the eye, and the blood was allowed to stand for 1 h at 37 ° C for 1 h, and 4000 rpm was centrifuged for 10 min, and the upper polyhytraminated serum was absorbed, and the dispensing was stored in -80 ° C.

[0065] Such as image 3 As shown, the above-mentioned osmium shrimp Trim50-LIKE protein polyclonal antibody can specifically bind to the pestinalized Trim50-LIKE protein of the plaque, and the different tissues of three healthy shrimps utilize fluorescent quantitative PCR and protein imm...

Embodiment 3

[0066] Example 3 Spotstine shrimp Trim50-LIKE protein with WSSV capsule protein interaction and in vitro ubiquitinization assay

[0067] (1) Spotstine shrimp Trim50-LIKE protein interact with WSSV capsule protein

[0068] First use the prokaryotic expression strain to express the purified WSSV vesicular protein VP19 (GenbankAccession No. DQ681071.1), VP24 (Genbank Accession No. DQ 199431.1), VP26 (GenbankAccession No. A220746.1) and VP28 (Genbank Accession) No.dq681069.1) figure 2 A-D Figure). For the specific implementation of the prokaryotic expression, as described in Example 1 (3), the original nuclear expression primer is shown below:

[0069] VP19:

[0070] RVP19-F GaattcatgcccaccacgactaacacacacAcCCCCCCCCCGACTAACAC

[0071] RVP19-R ctcgagttaatccctggtcctgttcttat

[0072] VP24:

[0073] RVP24-F GaattcatgcacatgtggggggTTTA

[0074] RVP24-R ctcgagtttttttcccccaaccttaa

[0075] VP26:

[0076] RVP26-F GGATCCACCCGTGTTGGAAGAAGCGT

[0077] RVP26-R GaattctTCTTCTTTTGATTCGTCCTTG

[0078] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a prawn E3 ubiquitin ligase TRIM50-like protein and a gene encoded thereof. The invention also discloses an expression vector containing the above-mentioned gene, a recombinant protein and an antibody that specifically binds to the E3 ubiquitin ligase TRIM50-like protein of prawns. The present invention further discloses the application of the above-mentioned protein or recombinant protein in the preparation of shrimp antiviral drugs or drugs for enhancing shrimp immunity, as well as the standard E3 ubiquitin ligase for in vitro ubiquitination detection, and the construction of an in vitro ubiquitination detection system Or the use of the kit and the identification and screening of E1 ubiquitinase or E2 ubiquitinase involved in the antiviral process in Penaeus monodon.

Description

Technical field [0001] The present invention belongs to the field of biotechnology, and more particularly to a spots of shrimp E3 ubiquitin ligase Trim50-LIKE protein and the use of this protein in the implantation of shrimp antiviral infections and in vitro in vitro. Background technique [0002] Post-translational modifications, such as phosphorylation, acetylation, and ubiquitinization, is an important biological process, regulating many intracellular signals. Ubiquitinization is one of the post-translational modifications modified by modulating DNA repair, differentiation, and immune response. Ubiquitinization is a highly conserved 76 amino acid molecules, ubiquitin molecules to covalently attached to the substrate protein. The ubiquitinization process requires three enzymes, E1 ubiquitin activation enzymes, E2 ubiquitin binding enzymes, and E3 ubiquitin ligases to complete activation, binding, and ligation, respectively. TRIM protein family (Tripartite Motif Family Proteins)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/00C12N15/52A61K38/53A61P31/20
CPCC12N9/93C12Y603/02019A61P31/20A61K38/53
Inventor 赵超邱丽华王鹏飞闫路路范嗣刚
Owner SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com